Zwar ist Bildung Länder- und im Falle des deutschen Innenministers, Thomas de Maizière, so weit es sich um Kenntnis des Islams handelt, eine Herausforderung. Aber das hält ihn nicht davon ab, mit einem schon hunderte Male gemachten Vorschlag in der bisherigen angeblichen Integrationsdebatte nun erneut aufzuwarten. Islamunterricht an deutschen Schulen und in deutscher Sprache soll, so der Innenminister, die Integration verbessern.

De Maizière sollte sich mal damit beschäftigen, wie sich der Islam an einer deutschen Schule auswirkt. Eine Möglichkeit, dies zu tun, zeigt PI dem Bundesinnenminister hier auf. Der Bundesinnenminister soll aber nicht den Eindruck haben, ein böser islamkritischer Blog phantasiere sich nun bestimmte Fakten zusammen. Wir weisen auf zwei öffentlich-rechtliche Dokumentationen hin, die die Verhältnisse an deutschen Schulen, in denen der Islam seine ganze Schönheit und Friedfertigkeit schon zur Entfaltung bringt, aufzeigen.

„Hart und Herzlich“ (Erstausstrahlung am 1. September 2010 um 23.30 Uhr in der ARD):

„Kampf im Klassenzimmer“ (Erstausstrahlung am 22.7.2010 in der ARD):


Anzeige: Wandere aus, solange es noch geht - Finca Bayano, Panama.


  1. Wussten Sie dass Winston Churchill als erster über den Koran sagte …der Koran ist vergleichbar mit Hitlers mein Kampf…

    Flyer zum ausdrucken und liegen lassen

    Wenn von den, zur Zeit 50.000 – 60.000 PI Lesern nur 10% jeweils nur 10 Flyer ausdrucken

    (nicht nur diese hier, es gibt jede Menge PI ler die Flyer und Aufkleber zur Verfügung stellen)

    und einfach an belebten Orten, U-Bahn, Bus liegen lassen, sind das täglich 5.000 – 6.000 Flyer die von bis zu 5 Menschen gelesen werden. Rechnet selbst hoch, was das im Monat an Kontakten bringt.

    Sei Teil der 10% und drucke mit.


  2. Genau so sinnvoll wäre es dann, im „Kampf gegen Rechts“, „Mein Kampf“ auswendig lernen zu lassen.

  3. Natürlich ist der Islamunterricht der Integration förderlich!!!

    Der Integration der Deutschlands in den Islam…

  4. Missionierung vom Feinsten.

    Dieser Politiker ist mehr tragbar für das deutsche volk, aber was amcht das deutsche Volk dagegen?

  5. OT

    hier ein paar Fragen zum Thema:

    Islam ist Frieden(TM)

    Welteroberung ist Frieden?
    Hass auf Deutschland ist Frieden?
    Hass auf Europa ist Frieden?
    Hartz4-Betrug ist Frieden?
    Parallelgesellschaften sind Frieden?
    Kindergeld als Lohn ist Frieden?
    Totale Gottesfurcht ist Frieden?
    Angst vor der Hölle ist Frieden?
    Fürs Töten ins Paradies ist Frieden?
    Terrorismus ist Frieden?
    Ausbreitung durch Hass & Gewalt ist Frieden?
    Religiöser Faschismus ist Frieden?
    Religiöser Fanatismus ist Frieden?
    Frauenunterdrückung ist Frieden?
    Kopftuch, Burka & Co. ist Frieden?
    Ermordung von Schwulen ist Frieden?
    Hass auf Juden und Christen ist Frieden?
    Hass auf Atheisten und andere Ungläubige ist Frieden?
    Hass auf den Westen ist Frieden?
    Lüge (Taqiiya) ist Frieden?
    Friedliche Menschen töten ist Frieden?
    Freiheitbejahende Menschen töten ist Frieden?
    Beschimpfung und Bedrohung ist Frieden?
    Inzucht und Verwandtenehe ist Frieden?
    Ungläubige töten ist Frieden?
    Dhimmis unterdrücken ist Frieden?
    Ermordung von Abkehrern ist Frieden?
    Sklavenhaltung ist Frieden?
    Zwangsprostitution ist Frieden?
    “Ehren”mord ist Frieden?
    Zwangsheirat ist Frieden?
    Ramadan-Bulimie ist Frieden?
    Sex mit Tieren ist Frieden?
    Sex mit Kindern/Babies ist Frieden?
    Anti-Kapitalismus ist Frieden?
    Anti-Demokratie ist Frieden?
    Diktatur ist Frieden?
    Sozialismus ist Frieden?
    Steinigung ist Frieden?
    Baukran ist Frieden?
    Schächtung und Tierquälerei ist Frieden?
    Genitalverstümmelung ist Frieden?
    Messerstechen ist Frieden?
    Raub und Vergewaltigung ist Frieden?
    Diskriminierung ist Frieden?
    Säure im Gesicht ist Frieden?
    Kulturvernichtung ist Frieden?
    Hass und Gewalt ist Frieden?
    Ausbeutung und Dhimmisteuer ist Frieden?
    Kopf abhacken ist Frieden?
    Hand abhacken ist Frieden?
    Nasen und Ohren abschneiden ist Frieden?
    Indokrination von Kindern ist Frieden?
    Prügelstrafe ist Frieden?
    Respektlosigkeit gegenüber Gesetzen ist Frieden?
    Hass auf Polizisten ist Frieden?
    Hass gegenüber Deutschen ist Frieden?
    Hass gegenüber Nichtmoslems ist Frieden?
    Hass gegenüber anderen Ethnien wie Kurden ist Frieden?
    Deutsche als Nazis bezeichnen ist Frieden?
    Stockvergewaltigung ist Frieden?
    Vergewaltigung unschuldiger Frauen ist Frieden?
    Verprügeln von unschuldigen Rentnern ist Frieden?
    Öffentlicher Vandalismus und Zerstörung ist Frieden?
    Brennende Städte und Anarchie ist Frieden?
    Angreifen von Feuerwehrmännern oder Krankenhauspersonal ist Frieden?
    Vermüllung und Ausbreitung von Krankheiten ist Frieden?
    Schmutziges Trinkwasser ist Frieden?
    Krankhafte Zwänge sind Frieden?
    5 mal am Tag beten ist Frieden?
    Landraub ist Frieden?
    Diebstahl und Abzocke ist Frieden?
    Mangelnde Hygiene ist Frieden?
    Vergewaltigung der eigenen Frau ist Frieden?
    Schlagen der eigenen Kinder ist Frieden?
    Brüder, die ihre Schwestern ermorden ist Frieden?
    Mafiöse Familienclans und Jugendgangs sind Frieden?
    Abzweigen von Spendengeldern ist Frieden?
    Geld verlangen und nichts tun ist Frieden?
    Penner und Behinderte mit Steinen bewerfen ist Frieden?
    Folter und Qual ist Frieden?
    Autos abfackeln oder beschädigen ist Frieden?
    Fremdes Eigentum zerstören ist Frieden?
    Ureinwohner aus den Städten in Richtung Land verjagen ist Frieden?
    Gebildete Menschen aus dem Land jagen ist Frieden?
    Touristen angreifen ist Frieden?
    Dreckige Hotels vermieten ist Frieden?
    Urlauber abzocken oder bestehlen ist Frieden?
    Christenverfolgung ist Frieden?
    Landesflaggen verbrennen ist Frieden?
    Hexen verbrennen ist Frieden?
    5 gegen 1 ist Frieden?
    Bibeln verbieten ist Frieden?
    Religionsfreiheit nur für den Islam ist Frieden?
    Den Holocaust gut finden ist Frieden?
    Hitler bewundern ist Frieden?
    Hitlergruß ist Frieden?
    „Juden ins Gas“-geschreie ist Frieden?
    „Freedom go to hell“-Plakate sind Frieden?
    Extremer Nationalismus wie zb. Graue Wölfe ist Frieden?
    Nazi-Hamas ist Frieden?
    Kinderschutzschilde sind Frieden?
    Kindersoldaten sind Frieden?
    Zivilisten als Schutzschild benutzen ist Frieden?
    Selbstmordattentate sind Frieden?
    Bomben im Bauch eingenäht sind Frieden?
    Bücher, Bibliotheken und Kirchen verbrennen ist Frieden?
    Kultur aus vergangenen Zeiten nicht schätzen ist Frieden?
    Fremde Kultur vernichten ist Frieden?
    Christen, Juden und Buddhisten ihre Länder klauen ist Frieden?
    Israelische Sportler ermorden ist Frieden?
    Israel hassen ist Frieden?
    600 Juden durch Mohammeds Hand köpfen ist Frieden?
    Ausbreitung mit dem Schwert ist Frieden?
    Jerusalem, die Hauptstadt Israels annektieren ist Frieden?
    Ländergrenzen nicht beachten ist Frieden?
    Raketen auf Zivilisten sind Frieden?
    Scharfschützen, die Zivilisten erledigen sind Frieden?
    Die Taliban unterstützen ist Frieden?
    Hetze und Propaganda im Fernsehen ist Frieden?
    Muslimische SS-Divisionen sind Frieden?
    Völkermord an den Armeniern ist Frieden?
    Leugnung dieses Völkermords ist auch Frieden?
    Aufruf zur nicht-Integration/Assimilation ist Frieden?
    Terroristenschiffe richtung Gaza schicken ist Frieden?
    Lügen über Gaza verbreiten ist Frieden?
    Lügen über die Juden verbreiten ist Frieden?
    Lügen über Amerika verbreiten ist Frieden?
    Drogenhandel ist Frieden?
    Menschenhandel ist Frieden?
    Straßenverkehrsregeln nicht beachten ist Frieden?
    Laut rumbrüllen ist Frieden?
    Muezzin plärrt vom Minarett ist Frieden?
    9/11 ist Frieden?
    Leugnung von 9/11 ist auch Frieden?
    Attentate in London sind Frieden?
    Attentate überall auf der Welt sind Frieden?
    Mehr als 16.000 Terroranschläge seit 9/11 sind Frieden?
    Kreuze in einem christlichen land verbieten ist Frieden?
    Atheisten verachten ist Frieden?
    Wissenschaft nicht schätzen ist Frieden?
    Wissen verachten ist Frieden?
    Deutsche oder andere nichtmuslimische Schüler mobben, schlagen oder gar seelisch foltern ist Frieden?
    Nichtmuslimische Lehrer nicht ernst nehmen ist Frieden?
    Dumm sein cool finden ist Frieden?
    Assi-Rap hören ist Frieden?
    Kampfhunde halten ist Frieden?
    Immer ein messer dabei ist Frieden?
    Bei jedem scheiß die Familie oder sonstige Leute rufen ist Frieden?
    Sich in öffentlichen verkehrsmitteln schlecht benehmen oder gar gewalt anzuwenden ist Frieden?
    Kleine Kinder, die fremdes Eigentum nicht schätzen oder sogar gegenüber Erwachsenen sich schlecht benehmen sind auch Frieden?
    Europäische oder blonde Frauen als Schlampen ansehen ist Frieden?
    Diese zu vergewaltigen oder in der Partnerschaft zu misshandeln, dasselbe mit möglichen Kindern, ist auch Frieden?
    Religionsfreiheit benutzen um Religionsfreiheit abzuschaffen ist Frieden?
    Demokratie nutzen um Demokratie abzuschaffen ist Frieden?
    Kapitalismus nutzen um Kapitalismus abzuschaffen ist Frieden?
    Gegen Reiche hetzen, aber selber gut verdienend sein ist Frieden?
    Deutsche vor Gericht als Untermenschen behandeln ist Frieden?
    Deutsche in ihrem eigenen Land zu unterdrücken ist Frieden?
    Deutsche ausrotten ist Frieden?
    Juden ausrotten ist Frieden?
    Nichtmoslems ausrotten ist Frieden?
    Apostaten töten ist Frieden?
    Sich über die Deutsche Sprache lustig machen, obwohl man in Deutschland lebt ist Frieden?
    Kein Deutsch lernen ist Frieden?
    Kein Englisch lernen ist Frieden?
    Studenten, die gegen den Westen hetzen sind Frieden?
    Studenten, die Attentate auf amerikanische Wolkenkratzer verüben sind Frieden?
    Nur den deutschen pass wohlen, aber sich nicht integrieren ist Frieden?
    Peitschenhiebe sind Frieden?
    Aufhängen ist Frieden?
    Den Sinn von Karikaturen nicht verstehen und diese verbieten wollen ist Frieden?
    Islamkritiker ermorden und bedrohen ist Frieden?
    Systemkritiker verselbstheisigen ist Frieden?
    Türkische (von der Türkei aus gesteuerte) Polizisten in Deutschland, sind Frieden?
    Türkische (von der Türkei aus gesteuerte) Organisationen in Deutschland, sind Frieden?
    Buzkashi (Spielball = Schafskopf) als Nationalsport ist Frieden?
    Menschen in Stadien ermorden ist Frieden?
    12-Jährige die Menschen bei lebendigem Leibe den Kopf abschneiden sind Frieden?
    Schächtung von Menschen ist Frieden?
    Schächtung von Soldaten ist Frieden?
    Islamgläubige dazu zwingen Arabisch zu lernen ist Frieden?
    Imame die gegen den nichtislamischen Teil der Welt hetzen, sind Frieden?
    Bedrohung oder Ermordung von Menschen, die den Islam modernisieren wollen ist Frieden?
    Bedrohung oder Ermordung von Autoren/Prominenten die die Probleme mit der Islamisierung ansprechen ist Frieden?
    Halal food, geschächtetes Fleisch, Fleisch von Tierquälerei ist Frieden?
    Döner aus Menschenfleisch ist Frieden?
    Sperma im Döner ist Frieden?
    Den Nachbarhund einfach mal so tot schlagen ist Frieden?
    Das Leben verachten ist Frieden?
    Tiere quälen und verachten ist Frieden?
    Hunde hassen ist Frieden?
    Angst vor süßen kleinen Schweinebabies ist Frieden?
    Vergewaltigung von Hundewelpen und danach muss die Hundemutter die toten Welpen betrachten ist Frieden?
    Mischung aus Mensch und Lamm kommt zur Welt, ist das Frieden?
    Friedhof ist Frieden?
    Friedhof schänden ist auch Frieden?
    Juden aus der Stadt jagen oder in der Schule mobben ist Frieden?
    Antisemitismus, Faschismus, Sozialismus und Rassismus ist Frieden?
    Schwulenhass, Frauenhass, Hass Hass Hass ist Frieden?
    Perverse Sexualausübungen oder Sexfolter sind Frieden?
    Gewalt im Fußball ist Frieden?
    Ausgrenzung von Nichtmuslimen ist Frieden?
    Die Sprache des Aufnahmelandes verachten ist Frieden?
    Nicht die Nationalhymne des Aufnahmelandes singen wollen ist Frieden?
    Beten vor dem Fußballspiel ist Frieden?
    Fußballspieler angreifen (von seiten der Fans) ist Frieden?
    Für all das den Nichtmoslems die Schuld geben ist Frieden?
    Menschen ermorden und sich dabei gerechtfertigterweise auf Allah berufen ist Frieden?
    Sexspiele mit Kindern (zb. in Afghanistan) sind Frieden?

    Bei bedarf noch weiterführen.

  6. Das Problem (Islam) wird zum Lösungs-Standart definiert (Islam-Lehre). Interessante Methode. Auch in Frankfurt am Main will die CDU die ganze Stadt islam-kompatibel umbauen und Kritik als Diskriminierung verbieten lassen! Verfassungsfeinde in CDU Hessen und den Grünen sowieso.

  7. ja super! bravo Maizière! Statt eines Verbots auch noch zuarbeiten.

    Ich habe das Gefühl, dass Politikern die Ängste der Bevölkerung egal ist. Statt die Gefahren einzudämmmen, noch Benzin ins Feuer.

    solange es noch so was gibt…

    Schweiz: Iman verteidigt Steinigung – sie gelte als Abschreckung

    ist ein friedlichen Miteinander kaum möglich. Die islamischen Fundamentalisten wird’s freuen.

  8. geht in die gleiche Richtung:

    Mehr Einwanderer sollen Lehrer werden,3672,8108477,00.html

    Da fehlen einem doch mal wieder die Worte. Anstatt den Migrantenkindern Deutsch, deutsche Werte, deutsche Geschichte und Kultur, die freiheitlich demokratische Grundordnung, Anstand, Sitte und Moral beizubringen soll jetzt unseren Kindern anscheinend noch mehr Mültiülti und Kanack vermittelt werden.

  9. Mir kommt die Domestizierungsversuche des Islam so vor wie eine Neuauflage des wilhelminischen „Am deutschen Wesen soll einst die Welt genesen!„.

    Die Vorstellungen von DeMaizière werden von der Zuversicht befeuert, dass so wie der staatliche konfessionelle Religionsunterricht erfolgreich die christliche Religion aus den Herzen der Schüler vertrieben hat, sich Muslime ganz ebenso ihre Religion werden austreiben lassen.

    Wenn er sich da mal bloss nicht täuscht!

  10. Dieser absurde Vorschlag beinhaltet die gleiche Logik, als wenn man im Kampf gegen Rechts den Nazis aus „Mein Kampf“ vorlesen wollte.. 🙂

  11. Ja, wenn man den Moslems auf Deutsch aus dem Koran vor liest, dass ich ein ungläubiger Hund bin, der weniger wert ist als jeder „Rechtgläubige“ und dass ich natürlich nicht die gleichen Rechte besitze, DANN ist das natürlich etwas Anderes! DANN ist die Integration ja wirklich gelungen! Wenn man ihnen auf Deutsch verkündet, dass auf den Abfall vom wahren Glauben der Tot als Strafe das einzig Richtige wäre und den Frauen, dass sie in der Ehe ihrem Mann stets zu Willen sein müssen, ja dann kann man zwischen Einheimischen und Moslems ja kaum noch unterscheiden! Vielleicht sollten die Neonazis als Kompromiss vorschlagen, dass sie versprechen, den nationalsozialistischen Unterricht ausschließlich auf Deutsch ab zu halten, vielleicht bekommen die dann auch eigene Unterrichtseinheiten, wenn sie so gut integriert sind.

  12. #2 froschy (08. Sep 2010 09:56)

    Wussten Sie dass Winston Churchill als erster über den Koran sagte …der Koran ist vergleichbar mit Hitlers mein Kampf…

    Und über den Islam sagte er:

    „Es gibt keine stärker rückschrittliche Kraft auf der Welt.“

    (würde sich auch noch gut auf deinem Flyer machen)

  13. Früher hat es nur mal im Chemie-Unterricht geknallt; bald wird es Sprengstoffexplosionen im Islam-Unterricht geben im Islam-Fach: „wir bauen uns einen Sprengstoffgürtel nach deutscher DIN-Norm“ …

  14. Die Eröffnende:

    1. Mustafa Kemal der Begründer der Türkei, genannt Atatürk über den Islam:
    1) “Diese Hirtenreligion eines pädophilen Kriegstreibers ist der größte Klotz am Bein unserer Nation!”
    2) „Der Islam gehört auf den Müllhaufen der Geschichte!“
    „Seit mehr als 500 Jahren haben die Regeln und Theorien eines alten Araberscheichs (Mohammed) und die abstrusen Auslegungen von Generationen von schmutzigen und unwissenden Moslems in der Türkei sämtliche Zivil- und Strafgesetze festgelegt. Sie haben die Form der Verfassung, die geringsten Handlungen und Gesten eines Bürgers festgesetzt, seine Nahrung, die Stunden für Wachen und Schlafen, Sitten und Gewohnheiten und selbst die intimsten Gedanken. Der Islam, diese absurde Gotteslehre eines unmoralischen Beduinen, ist ein verwesender Kadaver, der unser Leben vergiftet. Die Bevölkerung der türkischen Republik, die Anspruch darauf erhebt, zivilisiert zu sein, muss ihre Zivilisation beweisen, durch ihre Ideen, ihre Mentalität, durch ihr Familienleben und ihre Lebensweise.“
    Quelle: Mustafa Kemal Pâscha “Atatürk” (Jacques Benoist-Méchin, “Mustafa Kemal. La mort d’un Empire”, 1954)

  15. Und sexy wird der Unterricht auch werden im Islam-Fach Morderne-Islam-Kunst: Wir malen uns die vielen Jungfrauen ganz nackig aus …

  16. De Maizieres Vorstoß ist ein Schlag gegen den Industrie-, Technologie- und Wissenschaftsstandort Deutschland.

    Dieser Mann ist ein Zukunfts-und Bildungsrisiko.

  17. Jetzt geben die Etablierten angesichts der neueren Entwicklung richtig Zunder…
    Mehr Migranten in den öfftl. Dienst..
    Islamunterricht in den Schulen..
    und alle, die Migrantenkritik üben, sind oberflächlich, fremdenfeindlich, unwissenschaftlich, Rassisten, rechtsextrem und
    Hoffentlich hat Stadtkewitz ordentlich Zulauf…

  18. NEWS . NEWS . NEWS


    Jüdische Forscher haben in den Gen-Sequenzen den Islam-Text im Original gefunden und rücken den Code nicht raus.

  19. Religion ist reine Privatsache und hat an Schulen absolut nichts verloren. Ich würde meinen Kindern verbieten daran teilzunehmen. Es ist unverantwortlich unsere Kinder mit so einer brutalen, bluttriefenden Religion zu belästigen. Was sollen sie aus dem Islam fürs Leben lernen? Die Erniedrigung der Frauen, das Abschlachten von Andersgläubigen, die absolute Intolleranz, die Eroberungswut und Vernichtung anderer Kulturen? Oder was? Was steckt da für ein Ziel dahinter? Wem nützt das? Wer bezahlt dafür?

  20. Schon der zweite Innenminister in Folge, der eine „misère“ anrichtet …

    Ihr seit ein so deppertes Volk da oben … wahrscheinlich merkt Ihr’s erst, wenn der letzte von Euch seine Partei – wegen Mitglieder- und Wählerschwundes auf 1 Person – auflösen muss …

  21. @ #17 OGT

    Zu 2)

    Atatürk in Ehren, aber bis heute hat sich an den von ihm geschilderten Zuständen nichts geändert.

    Wie auch?

  22. Grobe bewußte Falschmeldung auf N24 in den 10 Uhr Nachrichten:

    „Die Thesen von Thilo Sarrazin verärgern die Bürger so sehr, dass die Partei in der Wählergunst abermals sinkt“

    Das ist doch wohl total falsch! 90 bis 95% sind pro Sarrazin. Die Partei leidet unter dem Ausschlussverfahren, nicht unter den Thesen eines Einzelmannes, der nicht einmal mehr Politiker ist.

  23. Auszug:

    gtgctttccctcttcctgcaacct (…)

  24. Statt Islamunterricht sollte lieber Integrationsunterricht gegeben werden. Für eine Religion, die sich bis heute jedem wissenschaftlichen Zugang verschließt, und noch ganz in einem archaischen Gottes- und Menschenbild verhaftet ist, sollte nicht noch durch zusätzliche Werbung von aufgeklärten Menschen eine Legitimation frei Haus geliefert werden.

  25. Bundesregierung will mehr Lehrer mit Migrationshintergrund

    Berlin – Mehr Lehrer mit Migrationshintergrund an den Schulen – das wünscht sich die Bundesregierung. Dies ist Teil des bundesweiten Integrationsprogramms, das einem Bericht der Zeitung «Die Welt» zufolge heute vom Kabinett beschlossen werden soll. Solche Lehrer könnten dazu beitragen, Kindern mit Migrationshintergrund mehr Chancen zu eröffnen. Nur die Hälfte der Lehramtsstudenten haben demnach Migrationshintergrund. Die Bildungspolitik ist Ländersache – Das Kabinett beschäftigt sich mit der grundsätzlichen Frage, wie die bestehenden Integrationsangebote weiterentwickelt werden können.

  26. Sure 5 Vers 33:

    Der Lohn derer, die gegen Allah und seinen Gesandten Krieg führen und (überall) im Land eifrig auf Unheil bedacht sind (? yas`auna fie l-ardi fasaadan), soll darin bestehen, daß sie umgebracht oder gekreuzigt werden, oder daß ihnen wechselweise (rechts und links) Hand und Fuß abgehauen wird, oder daß sie des Landes verwiesen werden. Das kommt ihnen als Schande im Diesseits zu. Und im Jenseits haben sie (überdies) eine gewaltige Strafe zu erwarten.


    Der Lohn derer, die bei uns gegen die Demokratie und die Freiheit Krieg führen und überall im Land eifrig auf Unheil bedacht sind, soll darin bestehen, daß sie umgebracht oder gekreuzigt werden, oder daß ihnen wechselweise (rechts und links) Hand und Fuß abgehauen wird, oder daß sie des Landes verwiesen werden. Das kommt ihnen als Schande im Diesseits zu. Und im Jenseits haben sie (überdies) eine gewaltige Strafe zu erwarten.

    Sure 2,191: „Und tötet sie (d.h. die muslimischen Invasoren), wo (immer) ihr sie zu fassen bekommt, und vertreibt sie, von wo sie euch vertrieben haben!“

    Sure 2,193: „Und kämpft gegen sie, bis niemand (mehr) versucht, (Vernünftige zum Islam) zu verführen, und bis nur noch das Grundgesetz gilt!“

    Sure 2,216: „Euch ist vorgeschrieben, (gegen die Muslime) zu kämpfen, obwohl es euch zuwider ist.“

    Sure 4,89: „Wenn sie sich gegen das Grundgesetz, dann greift sie und tötet sie, wo immer ihr sie findet.“

    Sure 4,104: „Und lasst nicht nach in eurer Bereitschaft, den Muslim aufzusuchen und zum Kampf zu stellen.“

    Sure 8,12: „Haut (ihnen (den Muslimen) mit dem Schwert) auf den Nacken und schlagt zu auf jeden Finger von ihnen!“

    Sure 8,39: „Und kämpfet wider sie (die Muslime), bis kein Bürgerkrieg mehr ist und bis alles an die Menschenrechte glaubt..“

    Sure 9,5: „Und wenn die heiligen Monate abgelaufen sind, dann tötet die Muslime, wo ihr sie findet, greift sie, umzingelt sie und lauert ihnen überall auf.“

    Sure 9,36: „Und kämpft allesamt gegen die Muslime, so wie sie allesamt gegen euch kämpfen.“

    Sure 9,123: „Ihr Europäer! Kämpft gegen diejenigen von den Muslimen, die euch nahe sind! Sie sollen merken, dass ihr hart sein könnt.“

    Sure 47,4-5: „Und wenn ihr die Muslime trefft, dann herunter mit dem Haupt, bis ihr ein Gemetzel unter ihnen angerichtet habt; dann schnüret die Bande!“

    So sieht der Koran andersherum aus, und man muss ihn ja wörtlich nehmen wie es immer so schön heisst.

    Sebastian Weilander

  27. Frage an die Mathematiker unter uns: Wenn 1000 Affen 1 Milliarde Jahre zufällig Texte auf einer Schreibmaschine schreiben würden, könnte dann zufällig der Koran raus kommen?

  28. sie alle sind von der angst getrieben.
    selbt die große usa macht kniefälle vor dem gewalttätigen glauben.

  29. Verantwortungsvolle Eltern flüchten doch heute schon mit ihren Kindern auf teure aber gute Privatschulen, weil sie vor den mohammedanischen Schülern die Flucht ergreifen, die sie ständig und gezielt am Lernen hindern!

    Die Forderung des kritikunfähigen Innenministers wird diesen Trend verstärken, wenn erst einmal mohammedanische Irrlehrer an deutschen Schulen ihr Unwesen treiben dürfen!

  30. Intelligenz-Frage: Reicht das Toilettenpapier aller Moslems dieses Planeten, wenn es verbunden wäre, bis zum Mond?

  31. Nach den ersten sieben Minuten kommt unmittelbar die Frage auf, warum wir diese Personen immer noch beherbergen.
    Uns ist doch fast allen klar, daß diese Zuwanderer ohne jegliche Chance sein werden. Sie werden vom Sozialtropf ihr ganzes Leben abhängen, weitere Gebärmaschinen und Dschihadisten in die Welt setzen, und damit langfristig das Sozialsystem in den bankrott führen. Nicht einmal ansatzweise sehe ich dort Talente, die unser Land angeblich so dringend benötigt. Fast überall nur Versager, die einen Pädophilen huldigen, der mindestens genauso dumm war, wie sie selbst. Wie lange will die Bundesregierung noch tatenlos zu sehen, bis das Faß übergelaufen ist? Schon heute verlassen immer mehr Deutsche Leistungserbringer das Land, sterben weg, neue kommen immer weniger hinzu.
    Da braucht nicht lange nachgedacht werden, um zu dem Entschluß zu kommen, daß das Land in der jetzigen Situation die nächsten Jahre nicht mehr haltbar ist.

    Wenn euch der Schweinefleischkonsum nicht gefällt, dann verlaßt dieses Land, und nehmt erst recht nicht das Geld an, welches durch Schweinefleischfresser erwirtschaftet wurde. Geht in eure Herzen und handelt konsequent. Ich kann nicht das eine verabscheuen, und gleichzeitig davon profitieren.

  32. #34 Glauben_ist_nicht_Wissen (08. Sep 2010 10:20)

    Nein! Denn sie benützen keins sondern Steine 😉

  33. Intelligenz-Frage: Reicht das Toilettenpapier aller Moslems dieses Planeten, wenn es verbunden wäre, bis zum Mond?

    Wenn dieses Papier nicht aus Stahl oder ähnlichem ist, wird es spätestens nach 10 M auseinander fliegen.

  34. Dadurch wird eine rote Linie überschritten. Dieser Innenminister bekennt sich jetzt offen zu seiner Verfassungsfeindlichkeit, indem er dafür eintritt eine Lehre, die ihren Anhängern gebietet, uns Deutsche zu ermorden, an unseren Schulen zu unterrichten. Ich gehe mal davon aus, dass diesem Innnenminister nur ein Islam light vorschwebt, dennoch wird die Terrorideologie des Islams damit an deutschen Schulen und von deutschen Schulen propagiert. Das ist eine Form der Unterstützung des Allahkrieges der Muslime gegen uns Deutsche und stellt einen schweren Fall von Hochverrat dar, der nach StGB §100, Friedensgefährdende Beziehungen, mit einer lebenslänglichen Freiheitsstrafe geahndet werden muss.

  35. Verfassungstreu und gegenüber unserem Volk verantwortungsvoll wäre es, wenn sich dieser Innenminister für den Unterrichtsstoff Islamische Gewaltkultur einsetzen würde. Denn es ist dringend notwendig, dass unsere Schüler davor gewarnt werden.

  36. #36 Alessandro-Sergio

    Richtig! Sie benutzen keines. Mit der Hand ist es ja viel ökologischer – vielleicht lieben die Grünen-(braunen) deswegen die Moslems so …

  37. OT:

    Zum GLÜCK ist der Schweine-Gülle-Wagen, der gestern in einem Ort explodiert ist und eine unglaubliche Sauerei angerichtet hat, nicht vor einen Moschee explodiert.

  38. Ich sehe das nicht so kritisch, denn ein deutscher Islamunterricht könnte einer Radikalisierung entgegenwirken.
    Ich war zwar mal evangelisch getauft, habe aber nie an Gott geglaubt. Brachte ich Anfangs in der Schule noch eine 5 in Religion nach Hause, als Strafe weil ich nicht geglaubt hatte, bekam ich später gute Noten dafür daß ich mich am Unterricht kritisch beteiligt habe. Ich kann mich nicht über den Religionsunterricht ab Ende der 70er Jahre beschweren. Es wurde mir kein Glauben indoktriniert, wie in der Kirche bei den Zwangsbesuchen (Konfirmation) oder durch andere religiöse Menschen, sondern wir haben uns kritisch mit allen Religionen auseinandergesetzt. Ich glaube schon, daß es besser ist, als die mohammedanischen Kinder mit dem Fundamentalismus von Eltern und Koranschulen alleine zu lassen. Man darf auch nicht vergessen: Man hätte, wenn die Lehrer das mitmachen, auch die Möglichkeit die Schüler und ihre Familien zu beobachten und ihre Haltung zu Deutschland und zum GG zu protokollieren. Man könnte die radikalislamischen Schüler bzw. Familien in Listen führen und diese dann bei kommenden Rückführungsinitiativen „bevorzugt“ behandeln

    Wie gesagt, es kommt auf die Ausrichtung an. wenn man den Koran mit der gebotenen Distanz behandelt, wie das 3. Reich in Geschichte oder „Mein Kampf“ in Deutsch, sehe ich da kein Problem. Man kann es ja auch zur Aufklärung nutzen!

  39. @#37

    die museln verwenden KEIN Toilettenpapier…

    die wischen sich ihren ar*** doch mit der hand aus….
    weißt du das nicht???

  40. Wir müssen aber auch die Neonazis integrieren!

    Also Schluss mit dem Schattendasein in Hinterzimmern und Vereinsheimen und der Ausgrenzung und Diskriminierung!
    Wir müssen die jungen Nazis erreichen und dürfen sie nicht den Altnazis überlassen! Daher müssen wir endlich wieder Rassenkunde, Welteislehre und „Mein Kampf“ in die Lehrpläne aufnehmen!
    Aus der Geschichte lernen wir, dass Nationalsozialismus eigentlich gut war und Hitler eigentlich nur Frieden wollte.
    Leider wurde der Nationalsozialismus von Fanatikern falsch ausgelegt, entführt und mißbraucht.
    Die moderaten Nationalsozialisten konnten sich dagegen nicht wehren und wurden vom Ausland, von der jüdischen Weltverschwörung aufgehetzt, mit den Fanatikern undifferenziert in einen Topf geworfen und bekämpft. Es blieb also auch den moderaten Nationalsozialisten nichts anderes übrig, als um’s blanke Überleben zu kämpfen und sich gegen die staats- und volkszersetzenden Juden zu wehren.
    Diese Geschichte darf sich nicht wiederholen. Daher muss der aufgeklärte, moderate Nationalsozialismus in unsere Gesellschaft integriert werden, um Schaden von Deutschland abzuwenden und Deutschlands Ansehen in der Welt zu bewahren.
    Es müssen deshalb umgehend große Summen bereitgestellt werden, nationalsozialistisch ausgebildete Sozialarbeiter („NazSozArb“) und Lehrer („NazsozLehr“) eingestellt und ein Nationales-Integrations-Ministerium geschaffen werden. Als Minister ist Generalmajor a.D.Gerd Schultze-Rhonhof einzuberufen. 🙂

  41. #31 Glauben_ist_nicht_Wissen (08. Sep 2010 10:18)

    Das wird gerne in den „Bio-Runden“ zitiert.
    Nein sie schaffen es nicht. Sie schaffen noch nicht mal zu schreiben: „To be or not be, this is the dilemma“

    Ursprünglich ging es aber um die DNA/DNS 😉

  42. wenn mein enkelkind erzählt, wie es in ihrer klasse zugeht, möchte ich am liebsten die flucht ergreifen.
    die lehrer und lehrerinnen sind alle gebrieft.
    es geht dort zu wie in einem saustall. die elitekinder sind rotzfrech und haben weder anstand noch können sie bis drei zählen. aus welchem grund die versetzt werden, weckt in mir spekulationen. es wird geduldet zum nachteil unserer kinder. lehrerin: „mir sind die hände gebunden“.

  43. Die Nicht-Ignoranten unter uns wissen doch schon 30 Jahre wie es in unseren Schulen zugeht. Den deutschen Kindern wird eine Gehirnwäsche verpasst und den „Migranten“ in den Arsch gekrochen! Es kommt was kommen muss, die Frage ist schon lange nicht mehr ob sodern wann!

  44. @ Glauben_ist_nicht_Wissen:

    Frage an die Mathematiker unter uns: Wenn 1000 Affen 1 Milliarde Jahre zufällig Texte auf einer Schreibmaschine schreiben würden, könnte dann zufällig der Koran raus kommen?

    Frei nach O. Kalkofe: Man sagt, wenn man 1000 Affen 1 Milliarde Jahre auf einer Schreibmaschine schreiben lässt, kommt dabei irgendwann Shakespeare heraus. Lässt man aber 1000 geistig behinderte Affen schreiben, gibt ihnen Alkohol und höchstens zehn Minuten, kommt dabei der Koran heraus. 😉

  45. Genossin Merkel revealed

    Ihr kometenhafter Aufstieg innerhalb der CDU, ihre Rolle in der Schwarzgeldaffäre (Kapitel: „Zuckerpuppe aus der Schwarzgeldtruppe“), ihre Einstellung zu ihrem Herzensanliegen, der Schaffung eines supranationalen EU-Staates, die Beziehung zu ihren Förderinnen Liz Mohn (Bertelsmann) und Friedel Springer (Bild u.a.) sowie ihre sonstigen Beziehungsnetzwerke (Besuche bei den Bilderbergern, CFR u.a.), auch ihre Rolle im Fall Hohmann und bei der „Friedmann-Affäre“

    Angela Merkel war übrigens schon wenige Wochen nach dem Aufdecken dessen krimineller Taten bei einer sogenannten „Welcome-Back-Party“ dabei sind allsamt höchst aufschlußreich.

  46. Tolle Idee. Warum lässt man nicht gleich Pierre Vogel als Lehrer unterrichten.

    Ein Islamunterricht ist eine Beleidigung für die ganzen Opfer die im Namen des Islam ihr Leben lassen mussten.

    warum nicht gleich wieder Unterricht mit Themenschwerpunkt: „Mein Kampf“ oder warum Hitler ein guter Mensch war 😉

    Wer den Islam so hofiert, der hat dessen Ideologie des Todes und Menschenverachtung nicht verstanden!!! der Islam gehört genauso geächtet und verboten wie die Ideologien der Nationalsozialisten oder Stalinisten!!!

  47. Sarrazin bewegt!!!!!!

    Es ist Leben in diese Republik gekommen.

    Das Stimmvieh zeigt durch etliche repräsentative Umfragen das Politik ,ausserhalb der Käseglocke, nicht so einfach zu machen ist.
    Das sieht auch der ungläubige Thomas (de Maiziere)so.
    Fluggs werden alte Frasen gedroschen und als neu verkauft.
    Den interessiert noch nicht mal „sein Geschwätz von Gestern“
    Nein einfach mal das Pferd von hinten aufzäumen,und das ganze als auflebende Intergrationsdebatte vorstellen.
    Klappt noch nicht mal im Kölner Karneval!!

  48. Am Samstag, den 11. September 2010 findet um 14.30 Uhr auf dem Marktplatz beim Rathaus in Stuttgart eine große Mahnwache gegen den moslemischen Terror und die Terroranschläge in New York statt.

    Setzt ein Zeichen und nimmt euch die Zeit und kommt nach Stuttgart!

    Hauptthema der Mahnwache ist:

    Nie wieder 11.September. Für Demokratie und Freiheit!

  49. Ich verstehe Euch nicht. Man könnte den Islam im Schulunterricht genauso aufklärerisch behandeln, wie das 3. Reich im Geschichtsunterricht. Nur, würde das natürlich zu Unruhe und haßerfüllten Angriffen seitens der Eltern gegen die Schule führen. Aber nun gut, dann kennt man seine Pappenheimer (Schön auflisten und wenn die neue rechte Partei mächtig genug ist, die Flugtickets ausgeben)

  50. Verdammter Verräter an Volk und Vaterland!!!
    Wir haben blutreich die Trennung von Staat und Kirche erkämpft, und dann bahnt ausgerechnet ein Christ-Demokrat dieser Terror-Ideologie den Weg in die Mitte der Gesellschaft. Dabei attackiert er ganz unverholen und direkt die die Schwächsten der Gesellschaft, nämlich unsere Kinder, die diesen ganzen Irrsinn ausbaden sollen. Frage: Wie lange wollen wir uns das eigentlich noch gefallen lassen???

  51. Ich habe noch keine Demonstration gesehen, wo Moslems gegen die Terroristen des 11. September laut schreiend demonstriert haben.

    Ganz im Gegenteil. Am 11. September sind viele tanzend auf die Straße gegangen und haben Süßigkeiten zur Freude des Massenmordes an 3000 Ungläubige an ihre Kinder verteilt.

    Sollte das uns nicht zu denken geben?

  52. P.S. Natürlich sollten keine Imame unterrichten, sondern richtige Lehrer! Biodeutsch und verbeamtet (Dienstpflicht gegenüber dem Staat!)

  53. Guess what!

    Lothar de Maizière: „DDR war kein Unrechtsstaat“

    Seine Begründung: „Wenn die DDR ein Unrechtsstaat gewesen wäre, hätte im Einigungsvertrag nicht vereinbart werden können, dass Urteile aus DDR-Zeiten weiter vollstreckt werden können.“

    oh mann!

    Der 1. Mai wurde von den Nationalsozialisten in Deutschland zum Gesetzlichen Feiertag ernannt. Da wir dieses Gesetz und so manches andere fröhlich vom Dritten Reich übernommen haben, kann das, wie die DDR folglich auch kein Unrechtsstaat gewesen sein.

    Die Entnazifizierung Deutschlands ist nicht abgeschlossen, solange Karl Ernst Thomas im Amt ist.

  54. Nach dem die so genannte „Islamkonferenz“ kläglich baden gegangen ist, versucht Genosse De Maizière nun das durchzupeitschen, was von seinem geistig umnachteten Vorgänger, dem Verräter Schäuble zugesagt wurde.

    Verräter ! :mrgreen:

  55. Es kommt noch besser. DIW Chef Zimmermann fordert eine weitere Bereicherung von 500.000 Menschen jährlich, weil wir Biokartoffeln sonst bis 70 arbeiten müssen. Hat er noch nicht mitbekommen, dass die Bevölkerung eine Stinkwut hat? Der Wettbewerb wie Diktator Nicalae Ceausescu starb ist anscheinend eröffnet. Jeder will wohl der erste sein. Die meisten Politidioten glauben wohl mittlerweile an Allah und sein Paradies mit der 72 jährigen Jungfrau. Oder sie haben die Zeichen der Zeit noch nicht erkannt und sind geil darauf eines Tages wegen Hochverrates am Volk aufgeknüpft zu werden. Mir egal. Wer es so haben will kann es gerne so haben. Mich kotzen diese Volksverbrecher nur noch an.

  56. @#66 clint isst wurst
    Ich bin jetzt auf Seite 120 im „Sarazzin“.
    Er argumentiert aber auch, daß wir aufgrund unserer geringen Geburtenrate stetig dauerhafte Zuwanderer brauchen, um eine Überalterung zu verhindern inkl. der Folge, daß die zunehmenden Rentner auch nicht mehr versorgt werden können. (Anm. Akademische Zuwanderer hätten auch keine besonders hohe Geburtenrate aufzuweisen)
    Er fordert aber, daß diese Zuwanderer hochqualifiziert (!!!) sind. In anderen Industrieländern eine Selbstverständlichkeit bei den Einwanderungsbestimmungen.
    Das Problem das wir haben ist, daß wir für die unqualifizierte Unterschicht einfach keine Aufgaben haben. 1. durch die Automatisierung 2. durch die Verlagerung der Produktion ins Ausland.
    Die Unterschicht die sich fleißig bei uns reproduziert hält er dagegen nicht für entwicklungsfähig und will anscheinend deren „Reproduktion“ verringern. Wie er das vorhat weiß ich noch nicht „Un dat annere Loch, dat hammer schpäder!“

  57. Wie der Film Kampf im Klassenzimmer zeigt, läuft der Islamunterricht an den Schulen in Deutschland und anderswo i Europa schon lange: durch Mobbing, Beleidigungen und tägliche Gewalt gegen Andersgläubige. Die Theorie wird korangetreu in die Islam-Praxis umgesetzt.

  58. P.S.: Ca. 25% meiner Kollegen hier, sind hochqualifizierte Zuwanderer. Nein, es gibt keine Probleme mit denen und sie geben Sarazzin uneingeschränkt recht!

  59. Warum nicht gleich Juden erschlagen als Leistungsfach?

    Aufrufe zum Mord – und natürlich zum Mornd allgemein – an Juden stehen in Deutschland unter Strafe.

    Deshalb ist es gegen das Gesetz, wenn eine Deutsche Schulbehörde Kindern Koranausgaben verteilt

    Steuergelder dürfen nicht dafür verwendet werden, Antisemitismus zu vebreiten.

    Es ist Wahnwitz, wenn der Verfassungsschutz Knöpfe beschlagnahmt, weil einer darin das Muster eines Hakenkreuzes zu sehen glaubt, aber der Staat Kindern Bücher in die Hand gibt, in denen das Erschlagen von Juden zur Heiligen Pflicht erklärt wird.

  60. Thomas de Maizière ist Erikas engster Vertrauter noch aus den DDR-Seilschaften und einer ihrer Politstrategen. Das eher diskrete Auftreten täuscht, er ist ein klassischer Strippenzieher.

    Ich bin mir immer noch nicht darüber im klaren, ob die Politeliten so naiv sind, an den „richtigen“, vulgo: friedlichen, Islam zu glauben oder ob es um eine aktive Unterwanderung unserer gesellschaftlichen Identität und Rechtsordnung geht.

  61. Dieser grosste Staatsverräter am Deutschen Volk gehört vor ein Kriegsgericht … er ist die grösste Misere der letzten Monate

    Frage : was wird dort für den Judas-Iskariot als Lohn bezahlt ??

    paar Goldbarren in der Saudi-Bank ???

  62. #66 clint isst wurst (08. Sep 2010 11:18)

    Wir müssen bis 70 arbeiten, weil uns die mohamedanischen Okkupanten jählich so viel kosten, daß der Staat kein Geld mehr für seine eigenen Bürger hat.

  63. Der Penner will jetzt Migranten, sprich Muslime, bevorzugt als Lehrer einstellen, dazu sollen sie Stipendien von 300€ bekommen, vom deutschen Steuermichel natürlich…

    Hallo? Ich arbeite meine Semesterferien durch damit ich mein Studium finanzieren kann und später kriegt dann Aische oder Ali mit nem 4,0 Staatsexamen meine Lehrstelle?

  64. Was unsere „Politeliten“ da fabrizieren grenzt -meine Meinung- schon an Vaterlandsverrat. Vor Wien haben unsere Vorväter den Halbmond geschlagen und jetzt sickern sie hier ein und zersetzen die Lebensweise und Wertauffassungen unseres Kulturkreises. PFUI!
    Prinz Eugen und Leopold I. drehen sich im Grabe um!

  65. Glanzleistung eines deutschen ministers.
    Den mitteldeutschen will er das vermeintliche nazitum austreiben – damit sie sich nach dem kommunismus unter die nächste knute begeben – unter die des islam.

    Grundgesetz – Artikel 20:

    (4) Gegen jeden, der es unternimmt, diese Ordnung zu beseitigen, haben alle Deutschen das Recht zum Widerstand, wenn andere Abhilfe nicht möglich ist.

    Es ist allerhöchste zeit dafür!

  66. Wieso Islamunterricht? Scientology wird auch nicht unterrichtet.

    Die Machtideologie hat das Religionsprivileg nicht verdient. Der Koran sollte aber von allen Schülern gelesen werden, um den wahren Islam offenzulegen und die Gefahr und Gewaltbereitschaft zu erkennen.

  67. wieso awaiting moderation ?

    Am besten den friedlichen Islam gleich “Einbürgern” – das fordert Gutmensch Claudia Roth !

    O-Ton Roth: Das auch ein “Ali” dann Polizist ist !

  68. Betrifft:

    Herr DeMaiziere,

    Sie sind gewiss gut beraten besonders gut aufzupassen was sie tun in Hinsicht auf den Islam.

    Der Islam ist das Wort des islamischen Gottes und deshalb unveränderlich und nicht interpretierbar ausser zum Zwecke der Irreführung [Taqiyya] im Sinne der langsamen Infiltration-Unterwanderung mit dem Ziele der Machtergreifung.

    Der Islam ist unter allen Gesichtspunkten eine in höchsten Maße kriminelle und menschenverachtende Politiideologie im Heiligenkleid.

    Die Grundzuege des IsLAm sind mit dem Grundgesetz der Bundesrepublick Deutschland, mit Meinungsfreiheit, mit Demokratie und mit Sekularismus UNVEREINBAR.


    Wenn dies nicht geschieht haben die Herrschaften Ihres Schlages die Verantwortung fuer katastrophalen gesellschaftspolitischen Konsequenzen Deutschlands zu tragen und sie werden als VerrÄter, Heuchler und Schreibtischkriminelle in die Geschichte eingehen. Die Menschen die in Zukunft die Geschichte des 21 Jahrhunderts studieren, werden wissen dass Sie entgegen allen Warnungen der Ideologie des Hasses und des Betruges den Teppich gelegt haben, dass sie dieser verachtenswerten Doktrin die Tore geöffnet haben und sie AKTIV hochgezügelt haben.

    Es nützt nichts dieser menschen- und freiheitsverachtenden Ideologie eine nette Maske überzuziehen um sie hoffähig zu machen bis sie in Deutschland und Europa auf Grund der Demographie einerseits und aufgrund der auf sexuellem Gebiet perversen und deshalb auch verführerischen Grundlagen in den Griff bekommt. Für viele Männer ist der Gedanke der totalen Ausgeliefertheit seiner Frau bzw Frauen u. der Kinder ein unwiderstehlich verführerischer Gedanke!!!

    Es nützt nichts wenn vorerst der Verfassungsschutz die Aktivitäten dieser Ideologie unter Kontrolle hält, denn morgen schon werden dieselben Institutionen auf natuerlichem Wege unterwandert sein. Die Unterwanderer werden NICHT gegen ihresgleichen vorgehen. Und am Ende haben IMMER diejenigen das sagen die die respektive Ideologie ERNST NEHMEN, und nicht diejenigen die nicht durchblicken oder nicht durchblicken wollen was da abläuft.




    Exegese (Tafsir) von al-Tabari
    „Wenn ihr (Muslime) unter der Autorität der Ungläubigen steht und ihr Angst um euch habt, so verhaltet euch ihnen gegenüber mit eurer Zunge loyal währenddessen ihr innere Feindschaft pflegen sollt. … Allah hat den Gläubigen verboten, daß sie anstatt mit ihren Glaubensgenossen mit den Ungläubigen auf vertrauten Fuße stehen und freundschaftliche Beziehungen pflegen – ausgenommen wenn letztere ihnen an Autorität überlegen sind. In einem solchen Fall laßt die Gläubigen freundlich gegenüber den Ungläubigen erscheinen.“

    “Laß uns ins Gesicht mancher Nicht-Muslime lächeln, währenddessen unsere Herzen sie verfluchen.” [Abdu Darda -enger Gefährte Mohammeds]

    Bukhari V7 B67 N427: wenn ich einen Eid geschworen habe und ich finde später etwas besseres, so tue ich dieses bessere und breche meinen Eid.[Mohammed]

    Bukhari V9 B89 N260:
    „Wenn immer ihr einen bestimmten Eid geschworen habt und findet? dann heraus, daß eine andere Weichenstellung von Vorteil wäre, so brechet den Eid und tut das bessere.[Mohammed]

    – der Islam verpflichtet seine Anhänger zum Allah-Krieg gegen das deutsche Volk zur Errichtung der Scharia

    – der Islam verpflichtet seine Anhänger dazu, diejenigen zu ermorden, die den Islam kritisieren

    – der Islam verpflichtet seine Anhänger dazu, diejenigen zu ermorden, die sich von ihm abwenden.

    Wer bei dieser Rechtslage meint, er könne dem Islam staatliche Rechte zuschustern, hat von unserer Verfassung keine Ahnung oder er arbeitet böswillig daran, unsere Verfassungsordnung zu zerstören oder er lässt sich von den Muslimfunktionären Geld in die Jackentasche stecken.

    Abu Dschaafar al-Tabari in „Tafsir“:

    „Wenn jemand genötigt ist, mit seiner Zunge vom Glauben abzufallen, um seinen Feinden zu entgehen, während er ihn in seinem Herzen bewahrt: Kein Tadel fällt auf ihn, denn Allah sieht nicht auf das, was sein Mund spricht, sondern auf das, was er in seinem Herzen wahrt!“

    WIR ALLE WISSEN was eine Moslem in seinem Herzen wahrt gegenueber den unglaeubigen Affen und Schweinen, denen die von deren ueber alles stehenden Goetzen Allah als “schlimmer als Tiere” definiert werden.

    Reissen Sie sich doch zusammen Herr DeMaiziere.

    Wir, die anstaendigen Buerger Europas werden unsere hart erarbeiteten Werte nicht an die Barbaren abgeben lassen, das koennen Sie sich getrost hinter die Ohren schreiben.

    Herbert Pedron

  69. #67 clint isst wurst (08. Sep 2010 11:18)

    „….sie haben die Zeichen der Zeit noch nicht erkannt und sind geil darauf eines Tages wegen Hochverrates am Volk aufgeknüpft zu werden. Mir egal. Wer es so haben will kann es gerne so haben. Mich kotzen diese Volksverbrecher nur noch an.“


    „Wer den Tod liebt, kann ihn haben“ (SPD)

    Bundesinnenminister Otto Schily, 2004 🙂

  70. #85 7berjer (08. Sep 2010 12:27)

    “Wer den Tod liebt, kann ihn haben” (SPD)
    Bundesinnenminister Otto Schily, 2004 🙂

    „Wer will kann gehen. Muslime müssen gehen“
    Rückführungsminister Ulfkotte im Jahre ???

  71. ich genisse jeden tag wie diese vollpfostenpolitiker sich drehen und wenden , alles versuchen tolle vorschläge zu machen um das volk zu beruhigen …
    nach dem motto schaut wir machen was


    doch der schönste tag wird werden , wenn es neue wahlen gibt. ich glaube soviel blöde politiker gesichter haben wir noch nie auf einen knall gesehen .


  72. Evangelischer Pressedienst

    Evangelischer Dialüg:
    Der evangelische Pfarrer der deutschsprachigen Gemeinde in Istanbul, Holger Nollmann,
    befürwortet islamischen Religionsunterricht an öffentlichen Schulen in Deutschland.
    Islam ist zu einem dauerhaften Bestandteil der deutschen Gesellschaft geworden.

    Er wird der nächste sein, der in der Türkei kommende Weihnachten am Christbaum baumelt!

  73. Wir kämpfen nicht nur gegen Politik und Medien, wir haben auch noch die Kirchen gegen UNS. Was ist bloß los in diesem Land?
    Deutschland und sein unendlicher Selbsthass!

  74. Da können wir dann unsere deutschen Kinder im Vorfeld der demographischen Entwicklung schon bestens integrieren.Danke Hr. De Maiziere. Solche aufrichtigen, aufgeklärten „Vordenker“ aus dem christlichen Abendland haben wir bitter nötig. Vielleicht bekommen Sie beim nächsten Besuch unseres Papstes in Istanbul einen Platz in der ersten Reihe seines Flugzeugs. Hasta la vista Baby.

  75. De Misere versucht nun mit Nachdruck, den Islam grundgesetz- und zivilisationskonform hinzubekommen, damit das Kartenhaus nicht zusammenbricht.
    Ich schätze mal, den Jungmohammedanern soll der „Euroislam“, also der Islam, den es nicht gibt, gelehrt werden.
    Den Jungmohammedanern werden die Hasssuren als „nicht zeitgemäss“ vermittelt werden.

    Blöd, dass der Euroislam ein Wunschtraum bleiben wird.
    Laut mohammedanischer Doktrin ist der Koran unveränderlich und ewiggültig.
    Ausserdem unfehlbar, da „Mein Koran“ direkt von Allah stammt.

    Den Bestrebungen der Regierung, den „Euroislam“ betreffend, werden verstärkt Bestrebungen der Moscheegemeinden entgegenwirken und damit weitere Probleme verursachen.
    Imam: „Die Kuffar versuchen, unsere Kinder zu Ungläubigen zu machen…“

    Im Endeffekt wird sich ein Grossteil der Mohammedaner weiterhin abschotten und in ihren unbeaufsichtigten Moscheen gegen die Kuffar hetzen, die versuchen, den Islam zu verbiegen.

    Und „wir“ verbrennen noch mehr Steuergelder, die unseren Kindern und unserer Gesellschaft zu Gunsten der Mohammedaner vorenthalten werden.

  76. Hier die Lehrplanfassung zum Islamkundeunterricht aus Bremen in Auszügen:

    >Auf die Besonderheiten und die heutige Bedeutung des Korans für die Muslime wird eingegangen. Hier bietet es sich an, religionsgeschichtliche und textliche Parallelen zur Bibel aufzuzeigen, um den Schülerinnen und Schülern den gemeinsamen Ursprung der Buchreligionen zu vergegenwärtigen.

    Der islamische Glaube mit seinen Verboten und Geboten beeinflusst die Lebensgewohnheiten und den Tagesablauf des Gläubigen erheblich. In einem nichtmoslemischen gesellschaftlichen Umfeld muss der Islamkundeunterricht deshalb in noch stärkerem Maße auf die Lebenssituation der Schülerinnen und Schüler eingehen, als dies für den Unterricht in „Biblischer Geschichte“ in einem christlich geprägtem Umfeld erforderlich ist.

    Der Mensch gilt im Koran als der „Stellvertreter“ Gottes auf Erden, als Sachverwalter der Schöpfung (Khalifa). Er muss somit eine Verantwortung für die Schöpfung übernehmen und soll seine Ehrfurcht vor allen Erscheinungsformen der Schöpfung bewahren.

    (Aha. Ehrfurcht. Indem er zum Töten aufgefordert wird, indem er zum Händeabschneiden und Auspeitschen bestimmt wird. Das nennt sich also
    Ehrfurcht vor der Schöpfung.)

    Grundsätzlich gibt der Koran allen Menschen, ob Mann oder Frau, schwarz oder weiß, arm oder reich denselben Stellenwert vor Gott und dem Gesetz.

    (Hä? Die Aussage einer Frau zählt vor Gericht
    nur die Hälfte, der Mann kann sie, also sein Saatfeld besteigen, wann immer er Lust hat, er darf 4 Frauen heiraten und soll sie schlagen, wenn sie ihm nicht
    gehorcht. Selber Stellenwert??)

    Lernziele u. a.:

    Soziale Kompetenz hilft

    – andere kennen, verstehen und achten

    – sich in die Gemeinschaft/Gesellschaft einbringen zu können

    – an Konfliktlösungen konstruktiv mitwirken zu können
    (Konfliktlösungen per Tötungsaufruf. Es ist unglaublich)

    – Regeln der Gruppe/Clique nach ethischen Gesichtspunkten zu reflektieren <

    Nachzulesen auf der offiziellen Schulbildungsseite der Stadt Bremen:

  77. Ich wäre für Islamaufklärung und keinen Islamunterricht, wenn die Kinder dort lernen würden wie sich diese menschenverachtende „Religion“ überhaupt verbreitet hat und dass der selbsternannte Prophet Mohammed in Wirklichkeit ein barbarischer Kriegsherr, Vergewaltiger, Polygamist, Massenmörder und Kinderschänder gewesen ist- hätte ich nichts dagegen.
    Da dem aber nicht so ist, finde ich es einfach lächerlich über so etwas zu diskutieren- andere Einwanderer fordern ja auch keinen Hinduismus-, Buddhismus-,Shintoismusunterricht und meines Wissens nach gibt es an öffentlichen Schulen auch keinen Unterricht für Slawen, die dem orthodoxen Glauben angehören und die Zahl der osteuropäischen Migranten in Deutschland ist sehr hoch und dennoch fordern sie so etwas nicht!!!

  78. Naja, die CDU geht wohl auf Stimmenfang, wie erbärmlich! Wenn selbst eine „konservative“ Partei wie die CDU es einmal gewesen ist, nicht mehr für christliche Werte einsteht und diese vertritt, wer tut es dann ?!

  79. Der Mann ist nur noch dumm dumm dumm. Der kapiert es nicht. Islamunterricht wird uns NIEMALS die Probleme vermindern oder wegmachen. Das Problem ist auch nicht in erster Linie ein Integrationsproblem, sondern ein Einwanderungsproblem. Der Unsinn beginnt schon, wenn man die Möglichkeit, Deutscher zu werden, allzu großzügig auslegt. Bei den Politikern läuft nur noch Quatsch ab – wir sollen völlig verdummt werden. Mal sehen, ob das was mit Herrn Stadtkewitz gibt, denn die Gelegenheit ist günstig und das Momentum muß man nutzen.

  80. Ganz offensichtlich kann Innenminister „die Misere“ (nomen est omen!) auch nicht gut rechnen. Eben in den Nachrichten: Nach seiner Ansicht sind 10 – 15 Prozent der Muselgranten integrationsunwillig. Gleichzeit gibt er aber bekannt, dass fast ein Drittel die Pflichtkurse in Deutsch vorzeitig abbricht. Da würde ich doch eher mal von gut 30 Prozent ausgehen, zmal die sich illegal hier Eingenisteten da erst gar nicht hingehen.

  81. Stephen Hawkins hat nach Jahrzehten intensiver Forschung erkannt – es gibt definitiv keinen Gott. Was macht Deutschland? Kaum zu glauben aber wahr – es führt den Islamunterricht ein. Wie blöd sind unsere Politiker? Wer bezahlt sie?

  82. #3 Schoensessel (08. Sep 2010 09:56)

    Genau so sinnvoll wäre es dann, im “Kampf gegen Rechts”, “Mein Kampf” auswendig lernen zu lassen.

    Interessanter Gedanke.
    Wieviele Menschen hatten damals das Buch gelesen?
    Sicher weniger als seither Muslime.

    Angenommen der Koran wird in der Klasse diskutiert, auf deutsch, mit den Mekka Versen, die dann von Medina Versen überlagert werden nach dem Genozid an den Juden. Dann natürlich das Leben des heiligen Propheten und der ganze Quark. Die Haditen, die Sharia usw.

    Jedes rebellische Kind mit halbwegs Intelligenz nimmt das doch nicht ernst, nicht ohne Rorstock.
    Das hat doch nicht mal der alte katholische Religionsunterricht gekonnt.

    Wenn alle Kinder wüssten was wirklich im Koran steht, ist der Spuk vorbei. Das nehmen die nie an. Das geht nur mit mit beschränkten Menschen in einem Gewalttätigen Umfeld ohne Bildung denen man einreden kann das Mohammed der perfekte Mensch war.

    Auch die allerlinkesten Pädagogen hätten ein Problem damit: Heute liebe Kinder sprechen wir über die Suren „Die Beute“ was verbindet ihr damit?….Piraten der Karibik…Somalia… Banküberfall…Raubmord…Neu Köln.
    Und schon ist der Unterricht im Eimer:-)

  83. „Integration ist, wenn man andere ausschließt.“
    Ja, dann wundert’s mich nicht, dass der bei uns eingereiste Orient mit Integration nichts zu tun haben will.
    Das ist ja dann was NEGATIVES.

  84. #33 Glauben_ist_nicht_Wissen (08. Sep 2010 10:18)

    Frage an die Mathematiker unter uns: Wenn 1000 Affen 1 Milliarde Jahre zufällig Texte auf einer Schreibmaschine schreiben würden, könnte dann zufällig der Koran raus kommen?

    Ich bin kein Mathematiker,aber ich kann diese Frage trotzdem beantworten.

    Antwort; Die Tatsache,das es den Koran gibt,beweist ,das es möglich ist!

  85. Islam im Schule!!!??
    …Sch…, Amateuren!!!!
    …Reine Idiotismus!
    …wo ist Religionsfreiheit?..für wem?
    …wo ist Ethik?…und für wem?
    …wo ist Selbstbestimmung?…und für wem?

  86. #103 Titanic (08. Sep 2010 18:43)
    Stephen Hawkins hat nach Jahrzehten intensiver Forschung erkannt – es gibt definitiv keinen Gott.

    HUK! Das Wort von S.H. gilt für alle Ewigkeit!
    …aber leider nur für IHN!!!

Comments are closed.