Es war Mitte April 2020, die Covid-19-Todesfälle waren in Europa auf einem Höhepunkt, als ein französischer Schäfer, Besitzer von Tausenden von Schafen, ein Video online stellte [siehe oben]. Darin erklärte er, wie er vorgeht, wenn er die Schafe scheren, impfen oder auf die Schlachtbank führen muss. Das effektivste Mittel: der imaginäre Wolf. Auf sein Signal hin, dass ein Wolf im Anmarsch sei, rennen die Schafe wie von Sinnen in den Stall. Dort angekommen, sind sie so froh, dem Wolf entkommen zu sein, dass sie alles mit sich geschehen lassen. Ob es den Wolf dann tatsächlich gab oder nicht, ist egal. Sie sind froh, in Sicherheit zu sein.

Im April starben Menschen an Covid-19, es wurden Ausgangssperren, Lockdowns und Schutzmassnahmen verhängt, um eine Überlastung des Gesundheitswesens zu vermeiden, die zu noch mehr Toten hätte führen können. Die Bedrohungslage bestand aus schweren Krankheitsverläufen, Hospitalisierungen, Todesgefahr. Heute muss man konstatieren: Der Kollaps des Gesundheitssystems ist nicht eingetreten, vielleicht auch dank den Massnahmen. In Deutschland meldeten Ärzte und Kliniken Kurzarbeit für 400 000 Menschen an. Von der Gefahr einer Überlastung des Gesundheitssystems redet inzwischen übrigens niemand mehr.

Kollabiert ist seitdem aber eines: die Kommunikation über das Virus. Das Virus entfaltet eine ungeahnte Nebenwirkung: Es befällt das Denkvermögen. Nun lautet die neue Gefahr: «Die zweite Welle ist im Anmarsch.» Besonders falsch sind da natürlich gerade Massendemonstrationen gegen die Corona-Politik wie letztes Wochenende in Berlin. Die Ansteckungsgefahr sei zu hoch. Erst versuchte man die Demonstration pauschal zu verbieten. Als das nicht klappte, rief man dazu auf, ihr fernzubleiben, es sei ohnehin nur eine Ansammlung von «Covidioten», Rechtsextremen und Reichsbürgern. Es ist ungeheuerlich: Politiker und einige Journalisten verunglimpfen pauschal Menschen, die gegen die derzeitige Politik demonstrieren. Man ruft erneut nach dem Wolf, aber immer weniger Menschen glauben offenbar, dass er kommt. Gibt es ihn denn, den Wolf?

(Weiterlesen in der NZZ)

image_pdfimage_print
Anzeige: Wandere aus, solange es noch geht - Finca Bayano, Panama.
Jetzt den PI-NEWS-Telegram Kanal abonnieren!

82 KOMMENTARE

  1. Ich weiß nicht, ob es den besagten Wolf gibt. Aber es gibt ein Riesen-Rudel von Schakalen. In der Politik, in den Medien, und überall an den Schaltstellen.

  2. Dann hat die Regierungeine besondere Karte gezogen, ich drücke es mal höflich aus: Die Regierung hat dann schlechte Karten.

  3. Von den angeblichen 17.000 Teilnehmern vom 01.08. und den angeblichen 30.000 vom 29.08. werden jetzt, sollte man der staatlich und medial propagierten hysterischen „Gefährdung von unschuldigen Menschenleben“ Glauben schenken, müssten schon jetzt die Notaufnahmen von Coronainfizierten bzw. schwer am Virus erkrankten aus allen Nähten platzen….

    Hab nirgend`s was gehört oder gelesen!

  4. Wenn gar nicht mehr abzustreiten ist, dass die Covidioten recht haben und (!) das auch immer mehr glauben, dann macht Merkel, wie schon so oft die Rolle rückwärts. Wieler und Drosten lässt man dann über die Klinge springen, das RKI wird dann komplett umgekrempelt (Karriere-Chancen für Whistlelblower der 2. und 3. Linie warten!) und Söder steht noch blöder da, als ohnehin schon.

  5. Wenn der Virus so gefährlich wäre,wie dargestellt und
    verkündet,brauchte man die Relativisten und Demonstranten
    nicht verunglimpfen.
    Genauso wenig wäre es möglich eine abweichende Strategie,
    von Bundesland zu Bundesland zu fahren,das verböte die
    Logik eines tödlichen Virus schon.
    Nein,heute ist es „Rein inne Kartoffeln,raus ausse Kartoffeln“,
    oder besser gesagt,heute Hüh und morgen Hott.
    Keiner hat wirkliche Ahnung, es ist ein Stolpern im dunkelen Raum.
    Und genau das begreift das Volk,es wird an Existenzen gesägt,und
    entmündigt und am Ende wird die Frage sein:
    „Wofür das alles?“
    Denkt an den Tönnies Skandal, wieviele sind an dem Virus gestorben?
    Ich kenne nicht einen Fall,und das spricht doch für sich..!
    Lasst uns den Wolf erlegen,wie damals die 3 Schweinchen,ihn wegblasen,
    und die Gehirnwindungen wieder frei blasen!

  6. Im April … Die Bedrohungslage bestand aus schweren … Todesgefahr…. «Die zweite Welle ist im Anmarsch.» . . .. Die Ansteckungsgefahr sei zu hoch….u.s.w.

    frage mich, wenn das Corona Virus doch so gefährlich vor allem durch Übertragung/ Ansteckung sogenannte Aerosole , eben der feinsten Verteilung herumschwebender Viren belasteter Gase in der Luft sein soll, wieso die Gesundheitsämter der Landkreise dann nicht dafür sorgen, dass die weggeworfenen Masken nicht separat in dafür extra bereitgestellte Sondermüll Tonnen und Behälter entsorgt werden
    Wieso gibt es keine geregelten Sondermüll-Sammelstationen für verbrauchte vielleicht Virus belastete …Mund-Nasen… Masken ?,
    sind diese verbraucht benutzten Dinger doch auch gefährlich wie es die Experten immer sagen, überall sieht man diese benutzen Dinger ( Masken) , wie gerade eben benutze Kondome vor öffentlichen Gender-Klos in Berlin oder Heroinspritzen im Berliner Görlitzer Park herumliegen,

    im Übrigen , hier mal zwei Meldungen … 23.8.2020 …Arbeitslosigkeit von Pflegekräften steigt https://www.welt.de/politik/deutschland/article214094938/In-der-Corona-Pandemie-Jetzt-steigt-sogar-die-Arbeitslosigkeit-von-Pflegekraeften.html

    26.08.2020 – Uniklinik Leipzig schließt Corona-Ambulanz https://www.bild.de/regional/leipzig/leipzig-news/kaum-noch-bedarf-uniklinik-leipzig-schliesst-corona-ambulanz-72584678.bild.html

    28.7.2020 Kliniken und Ärzte melden Kurzarbeit an *https://www.aerzteblatt.de/nachrichten/115076/Kliniken-und-Praxen-meldeten-Kurzarbeit-fuer-mehr-als-400-000-Mitarbeiter-an

  7. Mal nachlesen was Göring bei Nürnberger Komitee auf die Frage wieso die Nazis so viele Leute an sich binden konnten.
    Die Antwort ist hochinteressant!

  8. Angst, war, ist und wird auch in Zukunft DAS probate Instrument der Herrschenden sein, ihre „Untertanen“ dahin zu bringen, dass sie genau nach dem schreien, was die Herrschenden ihnen geben wollen!

  9. schinkenbraten 1. September 2020 at 14:49
    Dann hat die Regierungeine besondere Karte gezogen, ich drücke es mal höflich aus: Die Regierung hat dann schlechte Karten.

    eben das glaube inzwischen nicht mehr, die Regierung und die Medien weden es so hindrehen, daß Merkel viele Millionen Leben gerettet hat mit ihrer „umsichtigen Vorgehehnsweise“ vom Ende her denkend, wer macht das eigentlich nicht..“vom Ende her denken“ wenn ich z.B. auf eine heiße Herdplatte fassen will hole ich mir vom Ende her denkend Brandblasen um dies zu vermeiden, lasse ich es lieber, also vom Ende her gedacht und weise gehandelt.
    Die meisten Mitmenschen sind so voller Angst vor dem Virus das ist an sich schon krankhaft. Heute morgen beim Arzt saßen die Patienten im Freien anstatt im Wartezimmer, aus Angst sich anzustecken, vermummt versteht sich. Ich warte mal die ersten Grippewelle ab das wird lustig werden…voller Hysterie..
    …schon die Nazis haben das Volk durch Angstmacherei gefügig gemacht, es funktioniert heute noch, die Linksrotgrünen würden heute ohne mit der Wimper zu zucken über Leichen gehen und KZ`s einrichten um politische Gegner ud Anderstdenke zu eliminieren. Leider sind die ÖR und Tageszeitungen die einzigen Informationsquellen von Millionen Bürgen, sie glauben die Märchen die berichtet werden ohne sie zu hinterfragen….Ich tue es mir manchmal an in der Badischen Zeitung Leserbriefe im Forum zu lesen..( die Zeitung gibt mir der Nachbar am Abend, ich würde sie nichtmal als Klopapier verwenden, geschweige denn kaufen ) Es ist erstaunlich wie dumm und unaufgeklärt da erwachsene Menschen ihre mediengesteuerten Fehleinschäzungen abgeben, einfach nur traurig wie das Niveau der Allgemeinbildung in diesem Land gesunken ist. Information ist eine Holschuld ihr Schlafmützen da draußen und reichlich vorhanden, wenn man(n) und frau auch denn umfangreich informieren will…ich weiß zu anstrengend..

  10. Wenn das Virus in Art und Umfang für alle so gefährlich ist wie uns die Medien und Politiker weismachen wollen, brauchen sie sich doch über die „Covidioten“ nicht aufzuregen.

    Alle Teilnehmer der Demo haben sich dann gegenseitig angeteckt und fallen innerhalb der nächsten zwei Wochen tot vom Stuhl.

    Den Teilnehmern an BLM-Demos kann das natürlich nicht passieren. Schließlich zeigt das Virus „Haltung“ und weiß, dass es sich im Zusammenhang mit einer „guten Sache“ angemessen zurückhalten muss.

  11. Die Corona-Politik ist ebenso wahnhaft wie die Flüchtlings- und die Klimapolitik zuvor. Gegen jede rationale Betrachtung, gegen jede Vernunft wurde eine Massenhysterie erzeugt, um die Menschen auf Regierungslinie zu zwingen. Dazu gehört auch, dass Zweifler und Kritiker diskreditiert und kriminalisiert werden. Kein Wunder, dass Merkels infantiles Mantra vom „Wir schaffen das!“ gerade jetzt wieder von den Medien hervorgekramt wird! Diese Frau hat in 15 Jahren Regierungszeit eine Katastrophe nach der anderen angerichtet!

  12. „…. vielleicht auch dank den Massnahmen“
    ———————————————
    Daß die Schweizer kein „ß“ kennen, ist mir bekannt. Nun lese ich mit Grausen, daß ihnen offensichtlich auch der Genitiv abgeht.

  13. Früher hat man die Untertanen mit der Drohung von Fegefeuer und Höllenqualen eingeschüchtert, heute sind an die Stelle der angsteinflössenden Jenseitsvorstellungen Klimawandel, Feinstaub, Corona und andere angebliche Gefahren des Diesseits getreten. Die Inhalte mögen sich geändert haben, die Methoden sind die gleichen geblieben.

  14. Bierologe 1. September 2020 at 15:44
    „…. vielleicht auch dank den Massnahmen“
    ———————————————
    Daß die Schweizer kein „ß“ kennen, ist mir bekannt. Nun lese ich mit Grausen, daß ihnen offensichtlich auch der Genitiv abgeht.

    ———————————-
    Stimmt. Das ist der Einfluss des Alemannischen (Schwyzerdütsch), das kennt keinen Genitiv: „Meinem Vater sein Haus“.

    https://www.schweizerdeutsch-lernen.ch/blog/schweizerdeutsch-oder-schweizerisches-deutsch/

  15. Würstchenfriedhof Altmaier am 16. März 2020 bei „Hart und Unfair“:

    „Wir haben so viele Reserven, dass wir versprechen können, dass wir alles tun, damit kein Arbeitsplatz und kein gesundes Unternehmen wegen Corona schließen muss und verloren geht.“

    Würstchenfreidhof Altmaier am 28. März 2020 in einem Interview mit FAZ:

    Herr Altmaier, vor zwei Wochen haben Sie versprochen: Kein Job soll durch die Krise verlorengehen. Gilt das noch?

    „(…) Ich habe gesagt: Wir handeln als Staat, damit wegen der Corona-Pandemie kein Unternehmen insolvent werden und kein Arbeitsplatz entfallen muss. Wir tun alles, damit Beschäftigte und Unternehmen diese schwere Zeit durchstehen können. In der vergangenen Woche haben wir deshalb ein beispielloses Hilfsprogramm beschlossen. Wir wollen so die Substanz unserer Wirtschaft erhalten, damit wir nach der Krise wieder durchstarten können.“

    Muhahaha!

  16. Ein herrliches Gleichnis!

    Le bon pasteur – Der gute Hirte

    Jesus sagt: „Ich bin der gute Hirte, der sein Leben gibt für seine Schafe“
    Diese Gleichnisse kennen alle Christen aus dem Neuen Testament, sie sind ihnen vertraut.

    Tja, ihr dummen Schlafschafe…… Mutti ist keine „bonne bergère“, keine „gute Hirtin“ und Bedforth Strohm sowie Marx sind ebenfalls keine „guten Hirten“.

    Wacht endlich auf!

  17. Wahre „Covidioten“ sind die infantilen obrigkeitshörigen Panik- und Propagandagläubigen, die den sinnlosen Deppenlatz auch noch im Freien tragen. Zum Fremdschämen.

  18. Eule54
    1. September 2020 at 15:17
    FranzvonAssi
    1. September 2020 at 15:08
    Familienstreit in Rheinland-Pfalz..

    https://m.youtube.com/watch?v=7pyjSeiCWnE
    ++++

    Huch – das sind doch hoffentlich keine eingeschleusten Kuffnucken Ausländer?
    —-
    Ne, ne,ne.
    Das waren eindeutig Partypeople und ihre Eventmanager ..
    Alles gut 🙂

  19. @Hans R. Brecher
    Danke für die erhellenden Worte. Sympathisch sind sie mir trotzdem, die Schweizer. Schon deshalb, weil sie nicht in der EUdSSR sind!

  20. Hans R. Brecher 1. September 2020 at 15:38

    „Diese Frau hat in 15 Jahren Regierungszeit eine Katastrophe nach der anderen angerichtet!“

    Dass sie dafür installiert wurde, scheint immer wahrscheinlicher.

  21. Es ist doch ganz einfach.

    Unsere Regierung hat immer recht, das sagt uns die Regierung.

    Und da die Regierung immer recht hat und unfehlbar ist, müssen Leute mit anderen Ansichten, anderen Erkenntnissen und eigenständigem Denken logischerweise im Unrecht sein, weil die Partei sonst ja nicht im Recht wäre.

  22. Und was die süssen Häschen „Hilfen“ angeht, die der nette Onkel Altmaier in seinem Kämmerchen Ministerialbüro hat…

    Fall eins: „Ich krieg nix, ich bin alleinselbständig ohne Angestellte“

    Fall zwei: „Wir kriegen nix, wir haben das Wirtshaus noch nicht lange genug“

  23. Bierologe 1. September 2020 at 16:04
    @Hans R. Brecher
    Danke für die erhellenden Worte. Sympathisch sind sie mir trotzdem, die Schweizer. Schon deshalb, weil sie nicht in der EUdSSR sind!

    ————————————
    Gerne!
    PI bildet! 🙂
    In memoriam Viva

  24. Der boese Wolf 1. September 2020 at 16:05
    Hans R. Brecher 1. September 2020 at 15:38

    „Diese Frau hat in 15 Jahren Regierungszeit eine Katastrophe nach der anderen angerichtet!“

    Dass sie dafür installiert wurde, scheint immer wahrscheinlicher.

    ——————————————-
    Oder es ist ihr persönlicher Rachefeldzug, weil der Klassenfeind ihr geliebtes sozialistisches Vaterland übernommen hat …

  25. Vor lauter Wölfen (Pandemien, Klimawandel, Energiewende, Migration usw.) traut sich das gemeine, deutsche Einfaltsschaf schon gar nicht mehr aus dem Stall und die Schäferin (Mährkel) kann nach Herzenslust scheren, impfen und schlachten.

  26. Diese Darstellung mit den Wolf und den Geislein, erinnert mich an den damaligen durch die SPD incenierten Theater als die Milch ein pfennig teurer geworden war. Es ist fast das gleiche Spiel und die danach erfolgte Beruhigungen. Aber wer hat man nacgedacht, wem wir das Grundgesetz überhaupt zu verdanken haben und dazu auh schon damals das verbriefte Recht auf Demos beinheltet hatte, aber keine solche statt gefunden haben, obwohl es mehrere Anlässe dafür ergeben hatten. Erst seit dem Mauerfall, waren derartige Unruhen derart hoch geschnellt, das es zu demonstrationen gekommen waren. Doch von welcher Quelle kamen nun die Anlässe für die Unruhen, darüber sollte man auch einmal nachdenken und wer noch nicht von sozialismus inviziert wurde, weis es das diese Quelle der Kommunismus ist, der damals „noch nicht“ den Fuß in der Tür stecken konnte, aber nach dem mauerfall ihm wegen der demokratischen Ordnung, gelungen ist. So sind wohl mit Recht der vKommunismus zu bekämpfen wenn es entlich Ruhe im Lande geben soll. Und daran sind auch besonders die grün angestrichenen nazis beteiligt, absichtlich diese Unruhen zu erzeugen. Sind ja auch ein Produkt der Stasi gewesen. das diese es heute überhaupt gibt. Nicht nur die von der Stasi erzeugte ANTIFA muß verboten werden, sondern besonders die Linke und die Grünen. Die SPD mus mit einem eisernen Besen ausgekehrt werden. Aber die braucht doch Deutschland garnicht.

  27. Leute, kennt jemand einen vom Fach, also einen Virologen oder sonst einen aus dem Spektrum, der eine Untersuchung über den Anstieg der Infektionen, der daraus folgenden Erkrankungen und Todesfälle nach der BLM-Demo und nach der Anti-Corona-Demo, vom 1. August 2020, durchgeführt hat? Aus diesen Demos müßten doch exponentiell viele neuen „Fälle“ entstanden sein. Ich verfolge täglich das Worldometer, und da gab es für Deutschland keine besonderen Vorkommnisse, im Gegenteil, die ernsthaft an/mit Coronavirus Erkrankten und die Verstorbenen sind Promille der Einwohner der Bundesrepublik. Die Zahlen sind rückläufig. https://www.worldometers.info/coronavirus/

    Selbst Frankreich kann für gestern nur deshalb 29 Tote beibringen, weil welche vom Sonntag und welche mit anderen Krankheiten + Coronavirus erfaßt wurden. Der französische Pharma-Betrieb Sanofi arbeitet mit Hochdruck am Impfstoff, auch Betriebe anderer Staaten, die EU-Kommission unter der „Ehrenfranzösin“ UvdL hat schon Hunderte Millionen Impfdosen gekauft, die Aktionäre warten auf Riesengewinne. Nicht wenige der Regierungspolitiker Frankreichs würden direkt profitieren. Darum muß das ganze Volk unterdrückt werden und int Angst und Schrecken leben. Lest nur die Zeitungen Frankreichs, und Ihr seid mitten im Untergang des Abendlandes durch das Coronavirus. Es gibt nur Schreckensmeldungen, ständig werden Gesamttodeszahlen wiederholt usw.

  28. was soll der scheiß? neue umfrage bei insa: 54% vollidioten aus deutschland(dämlichland) wollen schwarz-grün. wofür den ar…ch aufreißen?

  29. Und was die angeblichen Neuinfektionen angeht, die in der NZZ genannt werden, die sind Neuentdeckungen durch einen gigantischen Anstieg der Tests. Olivier Véran, Gesundheitsminister Frankreichs, will ab heute in jeder Woche eine Million Bürger testen, bislang waren es 800 000 pro Woche. Wie das gehen soll, weiß ich nicht. Vielleicht klingelt ja mal jemand an meiner Tür, zwei Polizisten in Begleitung, und zwingt mich zum Test?

    Die Hysterie darf nicht aufhören. Das ist die Politik Emmanuel Macrons! :mrgreen:

  30. @ FranzvonAssi 1. September 2020 at 15:34
    Familienstreit Teil 2

    Oha – da geht es aber zur Sache. Eine Frage der Ehre??
    Pack schlägt sich, Pack verträgt sich. Altes Sprichwort.

  31. Bierologe
    1. September 2020 at 16:04
    @Hans R. Brecher
    Danke für die erhellenden Worte. Sympathisch sind sie mir trotzdem, die Schweizer. Schon deshalb, weil sie nicht in der EUdSSR sind!
    ————–
    Offiziell sind die Schweizer nicht in der EUdSSR aber faktisch müssen Sie alles mitmachen was in Brüssel bestimmt wird.

  32. Wenn die Covidioten (Zitat Saskia Esken) Recht hatten, hat Jens Spahn die Logistikaufgabe, seine 4 Millionen-Villa nach Paraguay zu transportieren, denn dann werden Bottrop, Hövelhof, Bergisch-Gladbach und Wuppertal überall sein.

  33. Goldfischteich 1. September 2020 at 16:38

    Aus dem Urlaub, und bei der Menge,die gefahren sind,
    egal ob ins Ausland oder in Deutschland verblieben,dürften
    sich um die 100 000 mit dem Virus angesteckt haben.
    Allein schon aus der Masse und der Wahrscheinlichkeit heraus.
    Und was tun diese Schergen vom RKI,jubeln uns Zahlen unter,
    die an die 1000-1500, als Höchstwert,genannt werden.
    Allerdings,es würde bei der bisherigen Politik,eine Massenpanik
    und der Schrei nach einem Lockdown,den sich keine
    Wirtschaft mehr erlauben kann, erfolgen,wenn man nur Zahlen
    um die 10-15 tausend nennen würde.
    Anhand der Zahlen kann man beweisen,daß das Deutsche Volk
    belogen und geframed wird, und dafür bedarf es keiner Lügner des RKI,
    das kann jeder in seinem stillen Kämmerlein berechnen und verifizieren!

  34. Maske runter und durchatmen: Das amerikanische RKI, das CDC, hat nun Entwarnung gegeben, sich hinsichtlich Todesfällen um 94% nach unten korrigiert und spricht davon, dass die normale Grippe fast 5mal gefährlicher sei als Corona.

  35. Auch interessant:

    https://pieceofmindful.com/2020/04/06/bombshell-who-coronavirus-pcr-test-primer-sequence-is-found-in-all-human-dna/

    BOMBSHELL: WHO Coronavirus-PCR-Test-Primer-Sequenz iüberall in der menschlichen DNA gefunden

    Tja, kein Wunder, dass so viele zwar positiv getestet, aber doch frei von Symptomen sind, wenn das hier stimmen sollte …
    Die Sequenz „CTCCCTTTTGTTTGTGTTTTTGT“ ist eine 18-stellige Primersequenz, die im Dokument des WHO-PCR-Testprotokolls für Coronaviren zu finden ist. Die Primersequenzen werden durch das PCR-Verfahren amplifiziert, um nachgewiesen und als „positives“ Testergebnis bezeichnet zu werden. Zufälligerweise findet sich genau diese 18-Zeichen-Sequenz wörtlich auch auf dem Homo sapiens-Chromosom 8! Soweit ich das beurteilen kann, bedeutet dies, dass die WHO-Testkits bei allen Menschen ein positives Ergebnis finden sollten. Kann das jemand anders erklären?

    Ich kann die Bedeutung dieses Ergebnisses wirklich nicht genug betonen. Zumindest sollte es einen nennenswerten Einfluss auf die Testergebnisse haben.

  36. „Es ist einfacher jemanden für dumm zu verkaufen, als jemanden davon zu überzeugen, dass er für dumm verkauft wurde“
    Mark Twain

    Das ist für mich das Motto der Woche

  37. Die NZZ stellt als letztlich dem System verhaftete Zeitung die falsche Frage. Es geht nicht darum wer recht hat. Es geht darum die offensichtliche Manipulation und Instrumentalisierung rund um das Virus zu benennen.

    Und in welcher Hinsicht soll man überhaupt recht haben? Kann es sinnvoll sein, um den Tod zu vermeiden Selbstmord zu machen? Welches „recht haben“ sollte denn die Maßnahmen rechtfertigen? Ich weiß nicht ob die NZZ das sauber beantwortet (begründbar ist es sowieso nicht). Dazu müßte ich es lesen. Aber das wird nicht klar gesagt werden. Vielleicht hat es jemand gelesen?

  38. @ Eurabier

    Der Spahn ist abgehoben, arrogant und nur an seiner Macht interessiert.

    Man erkennt als Außenstehender sofort, dass er die Menschen nur als Stimmvieh benötigt.

    Er ist genau so einer, der auch nur über die Köpfe der Menschen hinweg entscheidet und für sich höhere Ziele verfolgt.

    Chef von ganz Europa sein oder noch besser NWO Chef.

  39. „Eine zweite Welle ist im Anmarsch.“

    Diese ist aber hausgemacht. Es ist gesicherte Erkenntnis, dass Viren auch im Sommer vorhanden sind. Diese sind jedoch durch Hitze und UV-Strahlen geschwächt. Diese geschwächten Viren wirken wie eine Impfung. Durch Abstandhalten und weniger Kontakte kommen weniger Menschen mit diesen geschwächten Viren in Berührung. Diese natürliche Imfung fehlt dem Immunsystem somit. Es werden im Herbst/Winter viel mehr Leute erkranken, was uns dann als zweite Welle verkauft, und den „Covidioten“ angelastet wird.

    Apotheker klagen schon, dass sie in diesem Sommer kaum Erkältungsmittel verkauft haben. Zynische Antwort der Coronajünger: dafür habt ihr ja Umsatz mit Desinfektinsmitteln und Masken.

  40. AggroMom 1. September 2020 at 16:53

    Folgendes dazu gefunden:

    Hallo Steve
    Ich danke Ihnen für diese erstaunliche und kluge Detektivarbeit. Ich habe selbst einige PCR-Amplifikationsarbeiten durchgeführt, während ich vor Jahren als Forschungsassistent tätig war.

    Dies ist ein sehr wichtiger Fund. Ich hatte jedoch bereits Freunden gesagt, dass ich den Verdacht hatte, dass der Test absichtlich so gewählt wurde, dass er sehr, sehr unspezifisch ist, um sicherzustellen, dass alle Personen, die getestet werden, als „Covid-19“ herauskommen, ob sie gesund sind oder nicht, und zu verschiedenen Zeiten, um sicherzustellen, dass es nicht zu viel Verdacht erregt. Tatsächlich kann der Test überhaupt nichts Nützliches diagnostizieren.

    Ich machte einen Witz für einige Freunde, dass ein positives PCR-Testergebnis für Covid-19 und für alle anderen möglichen zukünftigen nicht-ethischen, geldverdienenden Betrugstests (unabhängig von der verwendeten Technik), die zur Täuschung, zum Vorantreiben der Impfung und zur Beschleunigung der Massen- und verdeckten Keulung/des Völkermords an der Weltbevölkerung eingesetzt werden könnten, ähnlich wäre, wie wenn man alle Menschen auf dem Planeten Erde auf das Vorhandensein von epithelialen Hautzellen testen würde, was nur darauf hinweist, dass wir tatsächlich Menschen sind.

    Nach Ansicht der Elite gibt es einfach zu viele von uns „nutzlosen Essern“, die unter dem Vorwand eines imaginären Killervirus ohne jegliche humanitäre Erwägungen eliminiert werden müssen, weil wir Sklaven sind, die keine unveräußerlichen Rechte haben, in Frieden und Harmonie zu leben und frei zu sprechen, bis wir aufgrund natürlicher Ursachen auf natürliche Weise aussterben. Ja, eine ungeheuerliche Behauptung, aber alle Wege führen nach Rom.

    Meine Argumente:
    1. Die Größe des amplifizierten DNA-Abschnitts ist sehr klein, etwa 100 bp lang. Unsere Körper sind voll von DNA und RNA, die ständig sowohl intra- als auch extrazellulär herumschwimmen. Das Vorhandensein eines angeblich sehr kurzen DNA-Abschnitts beweist nicht die Existenz eines Organismus.

    Wir atmen ständig Luft ein, nehmen Lebensmittel, Trinkwasser und Getränke zu uns und setzen unseren Körper auf natürliche Weise Chemikalien in Nanogröße, massiven Mengen fremder DNA und RNA, Bakterien, Pilzen und Parasiten aus, mit denen der Körper effizient und effektiv umgeht und die er auf die magischste, mächtigste und schönste Weise unschädlich macht. Einige Schrauben, die man beim Wandern an Land finden kann, deuten nicht unbedingt darauf hin, dass die Schrauben zu einem Flugzeug gehörten oder dass diese zu einem abgestürzten Flugzeug gehörten.

    2. Je kleiner das Amplikon (amplifiziertes Produkt) ist, desto größer ist die Chance, dass das Produkt auf einer Vielzahl von DNA-Sequenzen von verschiedenen Organismen, einschließlich des Menschen, gefunden werden kann. Aus diesem Grund ist die PCR nicht für die klinische Diagnose gedacht.

    PS. Dr. Kerry Mullis, Erklärung des PCR-Erfinders.

    3. Was Kill Gates of Hell und Fouchi und der Rest der Kabalen tun, ist zu sagen, dass die meisten, wenn nicht die ganze Menschheit mit diesen lustigen, unnatürlichen DNA-Sequenzen belastet ist, obwohl die DNA-Sequenzen in Wirklichkeit völlig natürlich sind; um die Erzählung von Impfstoffen als einzigen Ausweg aus dem potentiellen Virustod und der schweren Krankheit voranzutreiben, fabrizierten sie eine globale wirtschaftliche Katastrophe und in eine geplante Phase dystopischen Lebens mit einer immer kürzeren Liste von Menschenrechten und Freiheiten.

    Die Propaganda ist dazu da, bemerkt zu werden. Sie besagt, dass unsere spezifischen (Antikörper und T-Zell-Reaktionen) und unsere angeborenen (Makrophagen, Neutrophile usw.) Immunitäten nicht in der Lage sind, mit ihrer gefälschten Schöpfung fertig zu werden, und dass ihre hypothetische und erfundene Herdenimmunität nicht funktionieren würde, ebenso wenig wie ganzheitliche oder andere billige, bestehende, wirksame und sichere allopathische Behandlungen (Vitamin C, Zink, HCQ, Azithromycin, Vitamin D, Quercetin usw.). ), Transfusionen mit Antikörpern von denjenigen, die sich angeblich angesteckt und erholt haben, noch irgendeine andere prophylaktische Maßnahme oder Behandlung, die die Unternehmen, die Bill Gates Foundation, die Impfstoffhersteller und die U.N./W.H.O. daran hindern könnte, sowohl Milliarden/Billionen von Dollar zu verdienen als auch den größten Teil der Bevölkerung auf der Erde zu töten.

    Alle Wege führen nach Rom. Alle Präventions- und Behandlungsmodalitäten wurden und werden systematisch ignoriert, lächerlich gemacht, zensiert, abgelehnt und geächtet; alle zugunsten einer Liste von 666 Impfstoffen, die unseren Körper auf unterschiedliche Weise angreifen sollen.

    4. Die PCR-Technik ist die ideale Methode, um zu betrügen und eine Wahnvorstellung zu fabrizieren. Die Länge Ihrer DNA-Primer (Vorwärts- und Rückwärtsprimer, immer ein Paar) könnte verkürzt oder verlängert werden, wodurch die Spezifität des Annealing (Bindung an Ziel-DNA-Moleküle) beeinflusst werden könnte.

    5. Die Temperatur auf der PCR-Thermocycling-Maschine könnte gesenkt oder erhöht werden, was sich darauf auswirkt, ob die Primer spezifisch oder unspezifisch an eine schwimmende DNA binden!

    6. Es ist nicht erforderlich, dass viele Primerpaare eine perfekte Übereinstimmung mit der Ziel-DNA aufweisen. Einige haben nur eine 50%ige Homologie. Wenn Sie also angeblich eine Liste aller Primer erstellen, die zum Nachweis des angeblichen „Covid-19“ verwendet wurden, und sich die Gendatensequenzen ansehen, könnten Sie feststellen, dass die meisten, wenn nicht alle Primersequenzen, die Ziel-DNA-Sequenzen enthalten, mindestens 50% Homologie mit menschlichen DNA-Sequenzen aufweisen.

    SIE BRAUCHEN KEINE PERFEKTE SEQUENZKOMPLEMENTARITÄT/ÜBEREINSTIMMUNG ZWISCHEN IHREN ENTWORFENEN PRIMERN UND DEM UNBEKANNTEN DNA-SEGMENT ZU ERHALTEN, UM DIE ZIEL-DNA-QUELLE ZU VERSTÄRKEN.

    Somit könnte das amplifizierte Produkt leicht menschliche DNA sein, die als virale DNA maskiert ist!

    Sie maskieren uns, legen aber auch eine Maske auf das Ziel der PCR-Reaktion und das ist menschliche DNA, so dass wir die Ziele sind, die identifiziert und dann durch mehrere Generationen eines Impfstoffcocktails unter dem angeblich brennenden Wunsch, einen imaginären viralen Feind zu töten, zerstört werden. Sie sehen uns als ihren Feind an.

    Ich vermute, wenn Sie bei Ihrer Suche in der Datenbank des menschlichen Genoms eine 50-prozentige Ähnlichkeit/Übereinstimmung zwischen den entworfenen Primern und den menschlichen DNA-Sequenzen finden, dann könnte das bedeuten, dass die DNA, die als Quelle für die Labordiagnose von Covid-19 gezielt und amplifiziert wird, tatsächlich menschliche DNA ist und dass die veröffentlichten Primer an menschliche DNA-Sequenzen binden. Damit könnte der gigantische Betrug möglicherweise entlarvt werden.

    7. Die Konzentration des amplifizierten DNA-Produkts hängt von der jeweiligen Art und Konzentration des genetisch modifizierten DNA-Polymerase-Enzyms sowie von der Magnesiumkonzentration, der Konzentration der DNTPs, der Konzentration der ursprünglichen DNA-Probe, der Pufferkonzentration und den Bestandteilen, der Denaturierungstemperatur, der Annealing-Temperatur sowie den Verlängerungstemperaturen ab. All dies konnte manipuliert werden, um ein gewünschtes Ergebnis zu erzielen.

    8. Auch die Anzahl der Zyklen könnte verändert werden, was sich leicht darauf auswirken könnte, wie viel amplifiziertes Produkt hergestellt wird und damit ob die Probe mit Fluoreszenzlicht leicht nachweisbar wäre oder nicht. Eine Erhöhung der Anzahl der Zyklen und ein sehr sehr kleines, unwichtiges, harmloses, irrelevantes Stück schwimmender Junk-DNA könnte milliardenfach amplifiziert werden und plötzlich sichtbar, „relevant“ und irreversibel (d.h. anfällig für einen massiven Betrug) werden, so dass diese klinische Probe als positiv für Covid-19 markiert werden könnte. Plötzlich könnte eine sehr gesunde Person markiert, belästigt, eingeschüchtert und manipuliert werden, um ihre giftigen Toxine einzunehmen, die garantiert die Langlebigkeit und Gesundheitsspanne verringern.

    9. Die Größe des PCR-Produkts in der RT-PCR liegt zwischen 75-150 bp. Dies ist eine sehr geringe Größe, und eine Nadel im Heuhaufen zu finden, bedeutet nicht, dass diese Sequenz zu einem Killervirus gehört.

    Ein totaler und absoluter Betrug, über den wir alle Bescheid wissen und auf den wir alle angemessen reagieren müssen, indem wir andere informieren.

    Als Sie im März oder April, als dieser ganze Betrug begann, Exosomenbilder über Google suchten, war das Ergebnis genau die gleiche Darstellung, die sie ständig für Corona verwenden. So etwas findet man jetzt nicht mehr.

    Das ist vom 21. August

  41. 13. MAI 2020. Das Schaf zur Zeit des Coronavirus 6
    https://eussner.blogspot.com/2020/05/das-schaf-zur-zeit-des-coronavirus-6.html

    Liebe Freunde!

    Seit dem 17. März 2020, dem ersten Tag des Lockdowns, der bei uns Confinement, Ausgangsbeschränkung, Ausgangssperre heißt, war und bin ich nichts anderes als selbst das Schaf! Ich gebe zu, daß ich es erst jetzt, anläßlich des Déconfinements, der angeblichen Aufhebung der Ausgangsbeschränkung, Ausgangssperre, am 11. Mai 2020, so richtig begreife. Mein Schaf blökt in Personalunion mit mir. Ich bin nicht seine Herrin, sondern ich bin selbst das Schaf!

    Verwaltet werde ich durch die Hirten der französischen Regierung (Foto), die mir mit Dekret, vom 23. März 2020, bis zum 10. Mai 2020, vorschreiben, vorm Verlassen meines Pferchs eine Attestation de déplacement dérogatoire auszufüllen, eine „Ausnahmegenehmigung zur Fortbewegung“. …

    Blök!
    Euer Schaf,
    in den Pferch verbannt,
    will seine Freiheit zurück haben!

  42. Ja, liebe NZZ, was, wenn „die Idioten“ am Ende recht haben?

    Dann passiert auch nichts weiter. Man kennt das doch von Gegendarstellungen – Hauptsache, die Lüge wurde prominent auf der Titelseite herausgeplärrt, wenn dann irgendwann viel später die Gegendarstellung abgedruckt werden muss, so geschieht das ganz klein hinten im Heft, und keiner erinnert sich mehr. Lüge erfolgreich installiert.

    Die Geschäfte, Läden, Restaurants, Bars, Freizeiteinrichtungen sind vermutlich größtenteils insolvent oder pfeifen auf dem letzten Loch und werden Jahre brauchen, sich zu bekrabbeln. Die Schule ist wochenlang ausgefallen und immer noch nicht wieder richtig am Laufen (warum eigentlich?). Es gibt Probleme bei den Lehrstellen (vermutlich werden einfach weniger angeboten). Das Gesundheitswesen ist teilweise auf Kurzarbeit, was besonders die niedergelassenen Praxen trifft. Usw. usw.

    Ja, auch ich bin persönlich negativ betroffen, und mir ist es sowas von egal, ob ich am Ende recht haben werde – bis dahin bin ich nämlich schon vernichtet worden von diesem unserem Staate.

    (Und durfte mich obendrein von unseren Politikern andauernd aufs übelste beschimpfen lassen, weil ich mir einen Rechtsstaat und maßvolle, überprüfbare und vor allem zeitlich befristete Eingriffe wünsche. Es hat sich eine Menge Frust und Ohnmacht aufgestaut in mir.)

  43. INGRES 1. September 2020 at 17:01

    Die NZZ stellt als letztlich dem System verhaftete Zeitung die falsche Frage. Es geht nicht darum wer recht hat. Es geht darum die offensichtliche Manipulation und Instrumentalisierung rund um das Virus zu benennen …
    ____________________

    Wohl wahr. Man kann noch einen Schritt weitergehen und sagen, darum geht es letztlich auch nicht mehr. Es hat nur bis zu einem bestimmten Punkt, nämlich nur so lange es überhaupt angenommen wird, Sinn, neuen Wein in alte Schläuche zu gießen, weil die sonst bekanntlich platzen. Sprich, das System zu überführen und diese Gedanken in das System zurückzuwerfen. Dann weicht das System aus und setzt noch einen oben drauf. Und dem Überführer geht es wie einem Kind, das seine Eltern richtigerweise der Lüge bezichtigt: Es bekommt noch eine Ohrfeige wegen Frechheit und Stubenarest.

    Das System verhält sich weder rational noch freundlich, auch nicht menschlich, sondern eher wie ein Tier. Ein durchtriebender Hund, der zurückweicht, wenn er muß und zubeißt, wenn er kann und ansonsten stiehlt und frißt, was er kriegt. Es ist in der Tat kafkaesk. „Das Tier“ geht nur ein, wenn es nicht mehr geistig genährt wird, also keiner mehr folgt und an es glaubt. Und das hört nicht freiwillig auf, weil die Folger und Glauber sich im Vorteil und in Sicherheit wähnen. Das haben Sie meines Wissens selbst mit anderen Worten so vorhergesagt im Sinne eines Crash. Also kann man nur warten, bis sich das Tier selber verzehrt, was ja durch die unersättliche Gier passieren muß. Ohne mich damit befaßt zu haben, aber das wird wohl in der Mystik mit dem Symbol der Schlange gemeint sein, die beginnt, ihren Schwanz aufzufressen.

  44. Brother Grimm 1. September 2020 at 17:20
    „Eine zweite Welle ist im Anmarsch.“

    Diese ist aber hausgemacht. Es ist gesicherte Erkenntnis, dass Viren auch im Sommer vorhanden sind. Diese sind jedoch durch Hitze und UV-Strahlen geschwächt. Diese geschwächten Viren wirken wie eine Impfung. Durch Abstandhalten und weniger Kontakte kommen weniger Menschen mit diesen geschwächten Viren in Berührung. Diese natürliche Imfung fehlt dem Immunsystem somit. Es werden im Herbst/Winter viel mehr Leute erkranken, was uns dann als zweite Welle verkauft, und den „Covidioten“ angelastet wird.

    Apotheker klagen schon, dass sie in diesem Sommer kaum Erkältungsmittel verkauft haben. Zynische Antwort der Coronajünger: dafür habt ihr ja Umsatz mit Desinfektinsmitteln und Masken.
    ————
    Das hat Olivier Véran, Gesundheitsminister Frankreichs, vor aller Öffentlichkeit gesagt, daß ein Stop der Verbreitung dann kommt, wenn 50 – 60% der Menschen infiziert sind. Und dann sagte er, daß die Immunisierung durch Impfen das beste Mittel wäre. Deutlicher konnte er nicht begründen, warum die dämlichen Maßnahmen in Frankreich beibehalten werden: Die Menschen sollen sich nicht immunisieren, weil dann der Impfstoff nicht mehr verkauft werden kann.

    Es scheint auch nicht wichtig zu sein, ob der Impfstoff überhaupt wirkt. Die EU-Kommission zahlt Prämien für einen, der wirkt. Es steht alles im Internet, man muß es nur lesen. Leider ist die Mehrheit der die Bürger lieber nicht Bürger, sondern Schafe. Heute wieder an der Sonntagsfrage zu sehen. https://www.wahlrecht.de/umfragen/

  45. Der Merkellappen, das ultimative Symbol der Unterwerfung unter eine erratische Ideologiepolitik des Politbüros („Ein Ring Tuch, sie zu knechten…“), muß auf alle Fälle auf ewig erhalten bleiben. Jetzt legt Drosten los:

    In der ersten Folge nach der Sommerpause erklärt Virologe Christian Drosten in seinem Podcast, warum er das Tragen einer Alltagsmaske für wichtig hält. Er veranschaulicht das mit einer unappetitlichen Begegnung am Büfett.

    Damit zeigt Drosten, daß er komplett durchgeknallt ist:

    Zur Veranschaulichung lasse sich die Wirkung der Masken an einer Begegnung mit einem Menschen mit Mundgeruch zeigen. „Dieser Mundgeruch, das sind Aerosole“, sagte der Chefvirologe der Berliner Charité. Wenn sich etwa zwei Kollegen ohne Masken an einem Büfett begegnen und miteinander reden, bemerke der Kollege den Mundgeruch seines Kollegen. Wenn aber beide Kollegen in der Situation eine Maske tragen, werde der eine nicht mehr den Mundgeruch des anderen bemerken. „Dieses Nicht-mehr-Bemerken, das können wir auch damit übersetzen: Da kann ich mich nicht mehr so schnell infizieren.“

    https://www.welt.de/wissenschaft/article214790762/Christian-Drosten-Darum-wirbt-der-Virologe-so-nachdruecklich-fuer-Masken.html

    Wäscheklammer auf der Nase und und Knebel im Mund sollen auch ganz doll vor Mundgeruch und Corona schützen. Der hat doch nicht mehr alle Tassen im Schrank.

  46. Zu Goldfischteich 1. September 2020 at 17:53
    …..
    ist die Mehrheit der die Bürger lieber nicht Bürger, sondern Schafe.
    ——–
    So ist es, und die Jugend ist dermaßen indoktriniert. Lese gerade im WDR-Videotext (146), dass, obwohl es keine Maskenpflicht im Unterricht mehr gibt, auf Initiative von jüngeren Schülerinnen und Schülern am Burggymnasium in Altena weiterhin die Maske getragen wird.
    Merkel befiehl, wir folgen dir.

  47. Glauben_ist_nicht_Wissen 1. September 2020 at 16:51
    Maske runter und durchatmen: Das amerikanische RKI, das CDC, hat nun Entwarnung gegeben, sich hinsichtlich Todesfällen um 94% nach unten korrigiert und spricht davon, dass die normale Grippe fast 5mal gefährlicher sei als Corona.
    ————
    Das mit dem CDC soll nicht richtig sein, habe ich eben im Internet gefunden, von wegen der 9 210 Corona-Toten. Trotzdem ist der Rest richtig. Wenn’s nur ums Scheren ginge! Wir werden wie willige Schafe zur Schlachtbank geführt.

  48. @Religionsfeind

    Wie bereits im Kennedy-Thread gefragt: Haben Sie oder irgendjemand anderes das wörtliche Göring-Zitat zur Hand? Per Suchmaschine war ich mit verschiedenen Begriffsvariationen leider erfolglos.

  49. Brother Grimm 1. September 2020 at 18:07
    Zu Goldfischteich 1. September 2020 at 17:53
    …..
    ist die Mehrheit der die Bürger lieber nicht Bürger, sondern Schafe.
    ——–
    So ist es, und die Jugend ist dermaßen indoktriniert. Lese gerade im WDR-Videotext (146), dass, obwohl es keine Maskenpflicht im Unterricht mehr gibt, auf Initiative von jüngeren Schülerinnen und Schülern am Burggymnasium in Altena weiterhin die Maske getragen wird.
    Merkel befiehl, wir folgen dir.
    ————
    Das ist gewiß die FFF-Jugend. MannOMann, wenn ich bedenke, zu welchen Gruppen ich in dem Alter gehört habe!

    Hier hat eben AggroMom kommentiert, daß es zwecklos ist, Mark Twain hat sich ja ebenso geäußert.

    AggroMom 1. September 2020 at 16:56
    „Es ist einfacher jemanden für dumm zu verkaufen, als jemanden davon zu überzeugen, dass er für dumm verkauft wurde“. Mark Twain
    Das ist für mich das Motto der Woche

    Wenn ich noch in der Sache unterwegs bin, dann deshalb, weil ich nicht ruhig bleiben kann, ich würde platzen. 🙂

  50. Brother Grimm 1. September 2020 at 18:07

    Burggymnasium Altena will bei Maske bleiben
    Radio MK, Veröffentlicht: Montag, 31.08.2020 07:28
    https://www.radiomk.de/artikel/burggymnasium-altena-will-bei-maske-bleiben-700438.html

    Morgen fällt an den Schulen in Nordrhein-Westfalen die Pflicht, während des Unterrichts eine Maske zu tragen.
    ————-
    Es ist wirklich wahr! Ich habe das nicht glauben können. Deutschland hat sich abgeschafft! Ein Staat lebt von quirliger aufmüpfiger Jugend, nur von solchem Nachwuchs kommen später schöpferische Ideen. Jeder kann das an seinem eigenen Leben bestätigen. Wo sind denn die artigen Musterschüler geblieben?

  51. @ Babieca 1. September 2020 at 17:56

    …Der Merkellappen… Alltagsmaske …

    wenn ich das Drostische Gerede schon wieder höre, Alltagsmaske, als wenn dieses Ding bei allen Menschen schon in Mark und Blut übergegangen ist, von wegen Alltagsmaske, hier in D. gibt es wohnungslos obdachlose Leute die haben im Winter keine warme Kleidung aber bei minus zehn Grad zwischen Fußweg und Rinnstein liegend dann eine Alltagsmaske

  52. Goldfischteich 1. September 2020 at 18:38
    Brother Grimm 1. September 2020 at 18:07

    Altena? Da war doch mal was?

    Das ist die sauerländische Kleinstadt des Bürgermeisters Dr. Andreas Hollstein (CDU). Man erinnert sich? Er wurde durch den Angriff eines betrunkenen Mannes am Hals leicht verletzt und hatte „eine 15 Zentimeter lange Schnittwunde“. Er hatte so ’n Hals!

    L. S. Gabriel schreibt dazu auf PI, am 29. November 2017:
    „… durch vorauseilenden Gehorsam im Zuge der Invasionsförderung dient er der großen Umvolkerin. Die Stadt nahm mehr sogenannte ‚Flüchtlinge‘ auf, als sie gemäß dem Verteilerschlüssel eigentlich müsste, und Hollstein freute sich über jeden neuen ‚plus-deutschen‘ künftigen Wähler.“
    http://www.pi-news.net/2017/11/maischberger-mit-alice-weidel-zum-messerangriff-auf-altena-bm/

    Am 5. Oktober 2018 wurde ihm als Europa-Finalist der Nansen-Flüchtlingspreis der UNO überreicht.
    https://www.come-on.de/lennetal/altena/hohe-auszeichnung-andreas-hollstein-berlin-uebergeben-10305270.html

  53. Babieca 1. September 2020 at 17:56
    Der hat doch nicht mehr alle Tassen im Schrank.
    ————
    Der hatte noch nie Tassen im Schrank. Was heißt „Alltagsmaske“? Gibt es auch welche für Sonntags oder gar für Weihnachten? Für nächstes Osterfest?

    Am schärfsten ist, daß die meisten Masken gar nicht nützen, weil die Löcher im Stoff kleiner als 0,3-0,4 Micron sein müssen. 1 mm = 1 000 Micron.

    Ich habe zwei von deutschen Freundinnen selbst geschneiderte Masken, eine so nutzlos wie die andere. Um mich herum tragen die meisten Leute Masken, die nicht gegen Coronaviren geeignet sind. Sie kaufen sie im Pack, und auf der Hülle steht kleingedruckt, daß diese Masken nicht gegen Viren wirken.

    Ich will nicht 135€ bei Kontrollen zahlen. Einmal würde ich das ja noch machen, aber spätestens beim dritten oder vierten Mal drohen sie in Frankreich mit Knast. Du gehst in den Knast, wenn Du ihren Unsinn nicht gehorsamst ausführst.

  54. Ich werde gerade mit Artikel aus USA überrollt:
    Poste es einfach mal…
    Die Meldung sollte das Corona-Gebäude endgültig zum Einsturz bringen. Einem Bericht der US-Nachrichtenplattform „Gateway Pundit“ zufolge hat das CDC, das „Centers for Desease Control and Prevention“ – die amerikanische Seuchenschutzbehörde – die bisherige Zählweise bei Covid-19-Verstorbenen ergänzt. Nun wird offengelegt, wieviele Patienten tatsächlich an Covid-19 verstorben sind. Dies geschah jedoch still und heimlich – in den großen Medien wurde bis jetzt nichts davon berichtet. Das CDC stellte jetzt fest, dass statt 161.000 nur 9.600 Amerikaner tatsächlich an Covid-19 gestorben seien – also nur 6 % der ursprünglich genannten Zahl (Stand 26.8.2020). Alle anderen statistisch erfassten Covid-19 Toten hätten verschiedene, schwere Krankheiten gehabt, an denen sie gestorben seien, im Durchschnitt 2,6 Erkrankungen pro Person. Das deckt sich in etwa mit früher bekannt gewordenen Zahlen aus dem Hamburger UKE, wo systematisch Obduktionen von Corona-Toten durchgeführt wurden.

    Dazu Uwe Witt, Mitglied im Gesundheits-Ausschuss des Deutschen Bundestages: „Wenn in den USA jetzt die Zahlen so kommuniziert werden, dann muss die Frage erlaubt sein, wieviele tatsächlich in Deutschland an Covid-19 gestorben sind? Es hat den Anschein, dass in Deutschland niemand an diesen Zahlen interessiert ist und sie gar nicht erhoben werden. Wenn man den Anteil der tatsächlich an Covid-19 Verstorbenen von 6 % aus den USA zugrunde legt, stellt sich die Frage, wieviele der 9.300 Toten in der Statistik bleiben in Deutschland übrig? 558?

    Dafür tragen jetzt 70 Millionen eine Maske, knapp sieben Millionen sind in Kurzarbeit, 600.000 Arbeitslose sind 2020 bereits dazu gekommen, ganze Branchen und Industriezweige werden ausgelöscht. Das werden Sie uns erklären müssen, Herr Gesundheitsminister Spahn. War es das, was Sie damit meinten, man werden vieles verzeihen müssen?“

    In Österreich heißt es auf der Seite des Gesundheitsministeriums:

    „Jede verstorbene Person, die zuvor COVID-positiv getestet wurde, wird in der Statistik als „COVID-Tote/r“ geführt, unabhängig davon, ob sie direkt an den Folgen der Viruserkrankung selbst oder „mit dem Virus“ (an einer potentiell anderen Todesursache) verstorben ist.“

    Die Österreicher räumen wenigstens ein, wie sie ihre Zahlen ermitteln.
    Genau so oder so ähnlich werden angebliche Corona-Tote auf der ganzen Welt gezählt.

    Jeder, der der englischen Sprache mächtig ist, kann die Meldung aus den USA auf der Seite des CDC nachlesen:

    https://www.cdc.gov/nchs/nvss/vsrr/covid_weekly/index.htm?fbclid=IwAR2-muRM3tB3uBdbTrmKwH1NdaBx6PpZo2kxotNwkUXlnbZXCwSRP2OmqsI

    Die entscheidende Textpassage steht über Tabelle 3 unter der Zwischenübershrift Comorbidities:

    „Table 3 shows the types of health conditions and contributing causes mentioned in conjunction with deaths involving coronavirus disease 2019 (COVID-19). For 6% of the deaths, COVID-19 was the only cause mentioned. For deaths with conditions or causes in addition to COVID-19, on average, there were 2.6 additional conditions or causes per death. The number of deaths with each condition or cause is shown for all deaths and by age groups.“
    „Tabelle 3 zeigt die Arten von Gesundheitszuständen und beitragenden Ursachen, die im Zusammenhang mit Todesfällen im Zusammenhang mit der Coronavirus-Krankheit 2019 (COVID-19) genannt werden.
    Bei 6% der Todesfälle war COVID-19 die einzige erwähnte Ursache.
    Bei Todesfällen, bei denen neben COVID-19 noch weitere Erkrankungen oder Ursachen genannt wurden, gab es im Durchschnitt 2,6 zusätzliche Erkrankungen oder Ursachen pro Todesfall.
    Die Anzahl der Todesfälle mit jeder Bedingung oder Ursache wird für alle Todesfälle und nach Altersgruppen angegeben“.
    https://www.cdc.gov/nchs/nvss/vsrr/covid_weekly/index.htm

  55. Eine ausbleibende Pandemie ist entweder starken Zeichen für die Notwendigkeit der Pandemie-Schutzmaßnahmen durch die corona-kompetente Krisenkanzlerin in Berlin. Es kann aber auch nur bedeuten, dass es einfach keine Pandemie gibt, Corona-Maßnahmen hin oder her.

    Der bundesbürgerliche Untertan kann es sich aussuchen, ob das Spahnmerkel ihm vor dem sicheren Tod durch die Chinesen-Pest gerettet hat, oder ob die nackte Kaiserin und ihr Hofstaat ihn dem wirtschaftlich dem Untergang zutreibt. Am Ende hängt das vom Fraiming der Regierungsmedien ab, und die singen der besten Bundeskanzlerin aller Zeiten das Hossiana.

    Gerade deshalb sind schweizerische Medien lesenswert; quasi als „Westpresse“ der Merkel-BRD.

  56. Eurabier 1. September 2020 at 16:46
    Wenn die Covidioten (Zitat Saskia Esken) Recht hatten, hat Jens Spahn die Logistikaufgabe, seine 4 Millionen-Villa nach Paraguay zu transportieren, denn dann werden Bottrop, Hövelhof, Bergisch-Gladbach und Wuppertal überall sein.

    ————-

    Aber dieser Corona-Clown Jens Spahn hat doch auch Humor. Dass er nicht verstehen kann, dass die Menschen so einen Hass auf ihn haben, kann der Spahn doch nur als Gag gemeint haben.

  57. Hier ist doch eine weitere Möglichkeit, die Sterberate bei „COVID-19“-Patienten zu senken und künstliche Beatmung zu reduzieren.

    Blutverdünner halbierten in einer Studie die Todesrate bei Corona-Patienten
    Stand: 28.08.2020 | Lesedauer: 3 Minuten
    .
    Blutverdünner können bei Covid-19-Patienten das Sterberisiko deutlich senken. Das berichten US-Mediziner nach einer Studie mit knapp 4400 Teilnehmern im „Journal of the American College of Cardiology“. Demnach ging die Behandlung mit Blutverdünnern – unter Berücksichtigung des Zustands der Patienten – mit einer etwa halbierten Todesrate einher. Zudem war das Risiko für eine künstliche Beatmung um etwa 30 Prozent reduziert, wie die Gruppe um Valentin Fuster vom Mount Sinai Hospital in New York schreibt.
    […]
    Für Uwe Janssens, Präsident der Deutschen Interdisziplinären Vereinigung für Intensiv- und Notfallmedizin (DIVI) in Berlin, ist das Ergebnis keine Überraschung: „In den Kliniken ist schon lange bekannt, dass thromboembolische Ereignisse eine häufige Komplikation bei Covid-19 sind.“ Behandlungsempfehlungen dazu seien bereits im Juni in einer Leitlinie zahlreicher Fachgesellschaften zur intensivmedizinischen Therapie von Covid-19-Patienten veröffentlicht worden. Dennoch lobt Janssens die großen Datenmengen der aktuellen Studie. Es sei bei der Einlieferung von Covid-19-Patienten ins Krankenhaus sehr wichtig, sich viele Aspekte ihres Zustands genau anzusehen.

    https://www.welt.de/wissenschaft/article214510916/Covid-19-Studie-Blutverduenner-halbierten-in-einer-Studie-die-Todesrate-von-Corona-Patienten.html

  58. QBabieca 1. September 2020 at 17:56
    Drosten: „Wenn aber beide Kollegen in der Situation eine Maske tragen, werde der eine nicht mehr den Mundgeruch des anderen bemerken.“

    Wenn einer 2 Knoblauchzehen gegessen hat, riecht man das wahrscheinlich mit und ohne Maske.

    Das Beispiel von Drosten ist doch total bala-bala.
    Was will der anderen weismachen?
    Dass man mit Maske sauerstoffautark ist und nicht mehr ausatmen muss bzw. die Atmungsluft ständig regeneriert?
    Dass man als Einzelperson mit Maske ein geschlossenes System bildet ohne Luftaustausch mit der Umgebung?

    Funktioniert der Drosten-Trick auch, wenn die Maske schon seit April im Gebrauch ist und schon leicht angeschimmelt?
    Es gibt bestimmt nicht wenige, die die Maske nicht nach Stunden, oder täglich, wechseln.
    Vom unseren Politikern wird nur das Tragen vorgeschrieben. Mehr interessiert die nicht.
    Ein kostenloses 5-er Päckchen Masken jeden Tag gibt es nicht.
    Ob die Maskenatmung gesundheitlich abträglich ist, interessiert nicht.
    Wenn jemand eine Maskenvergiftung erleidet, ist das dann auch ein Corona-Opfer?

    Und überhaupt, in einigen Monaten/Jahren schwimmen die Milliarden Masken bestimmt im Meer rum.
    Dann schiebt wieder jeder die Verantwortung von sich.
    Etwas abmildern kann man das nur, wenn die Grünen ein Masken-Pfand durchdrücken.

  59. Lesefehler 1. September 2020 at 19:27

    Eine ausbleibende Pandemie ist entweder starken Zeichen für die Notwendigkeit der Pandemie-Schutzmaßnahmen durch die corona-kompetente Krisenkanzlerin in Berlin.
    —————

    Wir haben eine Gesichtsmasken-Pandemie.

  60. Goldfischteich 1. September 2020 at 18:56

    – Gesichtslappen –

    Ich will nicht 135€ bei Kontrollen zahlen. Einmal würde ich das ja noch machen, aber spätestens beim dritten oder vierten Mal drohen sie in Frankreich mit Knast. Du gehst in den Knast, wenn Du ihren Unsinn nicht gehorsamst ausführst.

    Deshalb ist so ein Rüsseltuch ja nichts anderes als ein Bußgeldvermeidungsvorhang.
    Magisches Denken: Was früher Knoblauch gegen angeblich überall raffende und reißende Vampire war, ist heute der Lappen gegen Viren.

  61. Aktenzeichen_09_2015_A.M. 1. September 2020 at 15:00;Am Samstag wurden doch kurzzeitig schon 38k zugegeben. Dass es tatsächlich viel mehr waren lässt sich schon daran ersehen, dass alle paar Minuten irgend eine Kleindemo medienwirksam und illegal verboten wurde. Dann noch die die auf der Tuntenparadestrasse liefen, da wären, selbst wenn die Abstände sklavisch eingehalten worden wären schon über 32.000 Leute drauf.
    Aber auch nur dann, wenn man den Vor und Nachlauf nicht berücksichtigt.

    rev1848 1. September 2020 at 15:23; Grade beim Durchzappen gesehen, Die Schande Südtirols und dabei irgend so ein Typ, der von nem Atombombenanschlag auf den Reichskriegstagbunker fabulierte.
    Tatsächlich wollten nur einige Dutzend Leute ein Foto von sich vorm siehe 1.Zeile oberhalb.
    Grade nachgeschaut, beim Typ handelts sich wohl um den hier bestens bekannten Berufslügner Sudelmeyer.
    Ich kenn den bloss vom Namen her.

    FranzvonAssi 1. September 2020 at 15:37; Das erinnert irgendwie an die Matheaufgabe mit den Kartoffeln,
    knollenförmoge Agrarprodukte, wo als Abiaufgabe alle Zahlen in der Aufgabenstellung unterstrichen werden sollten. Da gabs zuletzt doch den Passus, Diskutieren sie über die Aufgabe (Ohne EInsatz von Waffen)

    nicht die mama 1. September 2020 at 16:15; Fall 3 Allein im noch nie auf nen grünen Zweig bzw auf den Hund gekommenen Berlin wurden allein an Künstler mehr Soforthilfen ausbezahlt als im gesamten restlichen Deutschland.

    nucki 1. September 2020 at 16:44; Ohne zu wissen, dass diese Umfragen in den RG Parteizentralen durchgeführt wurden, sind die Zahlen völlig wertlos.

    Viper 1. September 2020 at 17:27; Könnte es sein, dass es gar nicht um diesen Intelligenzkillervirus geht, sondern dass das ein verkappte Methode ist um MassenDNAtests durchzuführen, ohne dass derjenige, der da hingeht was davon weiss.

    Goldfischteich 1. September 2020 at 18:56; Ich hab noch aus meiner Jugend so ein altes Netzshirt rumliegen,
    Falls mich jemand blöd anmachen sollte, weil ich ein Visier trage, dann wird das zur Maske umgeschneidert.

    AggroMom 1. September 2020 at 19:10; Irgendeine Zeitung hatte bei uns vor ein paar Tagen auch aufm Titel dass 85% der genannten Toten gar nicht an, sondern mit C gestorben sind. Aber auch das ist noch schamlos gelogen. Da wurde der 9er vorne vergessen und das Komma um ne Stelle versetzt. In Italien und bei uns liegen die tatsöchlicheb Corona Oüfer bei ca 1% der verkündeten. Warum es in Amerika 6% sein sollen erschliesst sich mir nicht so recht. Aber, dort haben viele keine Versicherung und die Ärzte sind für existenzbedrohende Rechnungen berüchtigt. Dazu leben auch viele in Slums, die Zustände dort kann sich hierzulande kein Mensch vorstellen.

    cpdstream 1. September 2020 at 20:27; Wenn die Maulkörbe im Meer schwimmen und sich die Fische damit anstecken, auch wenn die mit Kiemen atmen und gegen Gifte total unempfindlich sind, sind garantiert wieder exklusiv wir dran schuld. Obwohl wir so gut wie keinen Meereszugang haben, wenigstens im Vergleich zu vielen anderen EU-Ländern.

  62. Gespannt darf man sein, was sich die Nomenklatura nach Corona ausdenkt.
    Eine neue Angst fürs Volk, damit es brav volkt. Was hatten wir nicht alles schon die letzten Jahre von Klimahysterie bis Überalterung, von Nahsie (ein Dauerthema) bis Plandemie.

    Wie könnte man Meteoriteneinschläge politisch nutzbar machen?
    Oder eine Kampagne gegen fleischfressende Pflanzen; das klappt bestimmt bei der allgemeinen Verdummung. „Keinen Fußbreit den faschistischen nicht vegetarischen Pflanzen!“

  63. Friedolin 1. September 2020 at 17:50
    INGRES 2. September 2020 at 13:45

    Ja, mal sehen wie die Unterlassungs-Klage der Psychologin gegen das RKI ausgehen wird. Aber was heißt mal sehen, das Ergebnis dürfte klar sein. Aber noch müssen Richter ja immer eine Urteilsbegründung geben.

    Eigentlich ist es klar, dass man die Positiven-Quote (nicht die Absolute Zahl) angeben müßte um z.B. auch die Reproduktionszahl R zu rechtfertigen. Denn danach ist die fast zu 99 nur gesunken, während das RKI oft >1 angeben konnte.

    Aber u.U. können die Richter sich rein formal irgendwie rausreden. Und ich kann jetzt auch nicht beurteilen ob das juristisch formal möglich ist.

  64. INGRES 2. September 2020 at 14:07

    Ich habe anfangs häufiger das Bulletin des RKI aufgerufen um mir das R anzusehen, als ich das nicht nicht als die arglistige Täuschung erkannt hatte die es aufgrund der stark ausgeweiteten Tests ja ist (vielleicht waren die beim RKI auch zu dumm das zu erkennen).

    Oder um zu sehen, was sie zu den Quellen der Infektion angeben, also Unterschied Hotspot zu in der Fläche. Besonders interessierte mich möglicher Anti-Rassismus bezüglich Flüchtlings-Unterkünften usw. Bei letzterem hielt man sich durchaus bedeckt aber es ist erwähnt worden.

    Immer aber ist mir die Äußerung „sehr beunruhigend“ aufgestoßen (nicht nur, weil sie nie in Relation gesetzt wurde). Denn was hat ein sachlicher Dienstleister überhaupt eine solche Vokabel (Interpretation) abzugeben. Das kann man doch der Politik überlassen.

  65. @ INGRES

    Das mit der Unterlassungsklage ist in der Tat interessant. Ich bin noch nicht zum MSM-Lesen gekommen, aber ich glaube, davon steht nichts geschrieben. Immerhin zeigt das noch einen Funken letzter Rechtsstaatlichkeit und gesunden Menschenverstandes, auch wenn es nicht viel nützen wird, da sich die Hysterie bzw. illegale Instrumentalisierung schon weltweit verselbständigt hat. Aber es ist immer interessant zu sehen, wie „Das System“ auf Angriffe bzw. Reflexionen des verübten Mißbrauchs reagiert. Wahrscheinlich wehren sie das irgendwie juristisch ab, also setzen einen oben drauf (s.o.). Aber die Sache ist interessant.

  66. @AggroMom 1. September 2020 at 19:10
    „Bei 6% der Todesfälle war COVID-19 die einzige erwähnte Ursache.
    Bei Todesfällen, bei denen neben COVID-19 noch weitere Erkrankungen oder Ursachen genannt wurden, gab es im Durchschnitt 2,6 zusätzliche Erkrankungen oder Ursachen pro Todesfall.“
    Da sollte man auch betrachten wie häufig die Erkrankungen in der Altersgruppe ist z.B. sind 60% der Männer in Deutschland über 40 übergewichtig und dann ist Diabetes und Hypertonie nicht weit.
    Dan wird noch Kreislaufstillstand als zusätzliche Erkrankung genannt OK irgendwann schlägt das Herz nicht mehr.

  67. Die Covazis werden selbstverständlich NIE zugeben das sie unrecht hatten und im Prinzip schon immer das Gegenteil behauptet haben. So wie immer.

Comments are closed.